Description :
From Genome Similarity Track
Location :
Scaffold_34:106959- 109682
Sequence
2723 bases(100 bases per row)
CAGGCGCAAGCGCCTTATGGTCCACGAGAGAATGGTCATGATATAGCTTAAGCAAAGCCAACTTAAATCACTGGATGTGTGCGCAACTTGCGCGGGAGAT
TGAGTGTATAGGCAAGGCCTTTCTTCGCTATGACCATAAACGGCCCAATGAAGTGGGAACGCAATTTCGTCTTGAAGACGGCAGGCACTACATTTGTAGG
TAAGTCTTTATCATTTAATAAGACTTGGTCTCCAACTTCATAAGAATCAATATATCCTCTGCATTTAGCATCAGCTTGTTCTTTTTGTTTGTCTTGACTA
TCAGCAATAACATCACGCACAAGTCGTAAGACACTAAAGCGCGTCGCGAGAAACTCGATCAATTGTTTCTGTATCGTGGTAGGGCTGATTTCAGCAAGCT
TGTCAGCAGACTCTCCTCCACGAATCCCAGAACCACATAGTGGTAACGTGAGAGGAACACGGGGGTGCGTGAGGCTATTCACCTAGAAGGGAGTAAAGCC
GGTCGAGGCATGAAGAGCGTTGTTCAACGCAAACTCAATGATGGGAGCAGCGAGCTCCAAATATTAGGCTACTCAGCACAAACACTGCGAAGAACGTCGC
CAATGACGCGATTAACTCGCTCAGTCTTACCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCATCGCGTGCCAAGCACCTTGAAGATGGAAGTCCAA
AACTTGCCTGTAAAGCGAGGGTCGCGATTAGAGATGATTTCCAGCGGCAACCTTTGTTGACAAAACACACGATCGATAAACAGCGTAAATGCACCTTTGC
CATCGTAGGAATTCGGCAACGCCTCCAAGTGAGCCATCTTGCTTAAACGGTCAACAAAGACAACAATACTCGTATTTCCTTCGCAGTCTTTGGGAAGACC
AAACACAAAATCCATACTGATGGACTCCCAGCACCACGTGAGAAAATGCAAACTAGCGAGTGGCGCAGCCGAATGTGCCAAAGGTTTGACCCCCTGTCAC
TTTTCGCATGTACGCACGTATGTGCTCACCCATTTGTAGAGTTTGGGCCACCAGTAGGGTTAACTAACAGATTGATAAGTCTTTTCCCGGGCCAAATGCC
CACTGATGGCAGTATCGTGGGTCTCAAAGAGGAATCGATAATTTAAATCCTCATTATGAGGCACAACAATGCGAGAGGGTTCCGCTACATCTGTGCGATA
GCACAAAGGCCATTATCGATGGAATATCGATGTAGACTGGCCCGCAAGCGTGCCGATAAATGAACGTCCGAGGCCTTGTATTCCTCACTACCAACGGCAT
GAAACAATGACACAGATTAAGGGTCCCGTGGATATGCCACACGAATTAACTCCTCAATAGAAGACGACAAAGTCGTACATGAGCAAGCTCATAATCAGAT
TGGCGAGGGAGGGCATCTGCCAACACATTTTGTTTGACTGGCTTATACTTCACCTCGAAGTTATATTTCGCAAAGAAGGAAAACCACCGAGCCATTCTCT
GAGGGAGGTGAGGCGAATGGGTCGCCGTACCTAATGACGCATGATCCGTATAGACTACGAATGCCTTGGAGCCAAGCAATGAACTCTAATGTGACAAGTG
CATACTTCATAGCAAGTTACTATTTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTCAGATGACGAGATTCAAATGCGATAACTCGCTCGCGGCCTGC
AGCATCTGTTTGTAAGAGGGCGCTGCCTATAGCAGAATCGGATGCATCGCAGACATCACTAAAAAGGTACTCAGGATTTGGCAACGCCAAAATGGGAGCA
TGGAGGAGACTCTCCTTTATTGCCAGAAATGCGTCAGCATAGGTGTTGTCCCAGCGCCAATCTGTGCCCTTCTTAAGGAGATCAGTTAATGGCCGAGCCA
TATCAGCGTAATATTTACTGTATTTGTGTAAGTAATTGGAAAGGCCAAGCCATTTACGTAAGTCTTTTTGGTTATTAGAAATCGGCCAGTCCACTATAGC
CTGGACCTTAGCGGGATCCGCTCTGAGGCCGCGCTTGCCAATGAAATAGCCGAGAAAATGAATCTCCTCTGTACCACCAATAAATTTAGACGCGTTGGCG
TACAGTTTATTAGTGCGCATGCACTCGAGCACGGCTCGCAAATGACCGATGTGGTTTTCAACATCTGACCGACCTTTTTCGGCACGACTATGGACAAAAA
TGTCATCAAAGTACGTCTGTGCGTAATCTCGACGTGGCAGAAAAGTTACGTCACCAGACGATTAAATGTTGCCGGAGAATTAGACAGCCCTTGGGGCATC
ACCAGCCATTCTCATAGCATACCACTTGGGATGCGCACTGCTGTAAGCGGAATACCACTAGCTCGCATGAGCAATTGATAACAATCCATCGACCAAGCCA
AGTGCGCTATACATAGTACAACCAACCATGTTGTTTCGTAGAGCATCTTTTCGAAGAATAGGTGTCTGTGCCGGAATAGTAGCCGCATTAAGCTTTGTTA
TAAGCATGCACAATATGCCACTTGCCGTTCGGCTTTTTGACACAAAATATCGGTGTCGAATGTGGAGATTTACTCTCACGTATCATTCCTGCCTCGTGCT
TAGCACGGAAGAAGTCATCAATGACATCACATTGCCCATTAGACAAGGGTCACTGTCGTGTGACACAGTATTTAGTCCCAGGAACTAAGTCAATTTCATG
ACGGACACTTCTATCTGGAGGTA