Description :
From Genome Similarity Track
Location :
Scaffold_100:106949- 108452
Sequence
1503 bases(100 bases per row)
AGCAATCTGAAAGAGAAATTATATCAGTCATTTTTGTCTTTTCATTCTCCTTGCATGTCGTTTTTGTGTCTGTGAGAAAATATTTACCCCGTGTTTGCGC
GACGACAGTTTGTTCTTTTTGTTTTTTTGGAGGTGTGTTGTGCTAGTGCTGACGGTATTTCTCGTGGTCGGTACCATTTACTAGTGATTGGGATCTCCAA
GTATTTTAGACTACGTTGCGCATACGATCTGCCGAAATGATACAACTCCTATTGGTAGTTTGTACTGGCGATTCAAATTCGTGACAGGCCTCTACGTTTT
GTGACGGACCTTGGCTGGTTGCGTGGCAAGTTGTGGTTGCAGTAAGCATGTTACGATTACGAAGCTGTGCAGCAAAAGAACCTTTCACAAGAATCTGACA
GGAGACAACTGAAAGAATGTCGTGGATTTCAAACTGGATGCTCTTCTGCTGTTTATACTTATTCCAATCTCGCTTAGTTGACCATTTTCTATTGGCAATG
CATGTGATAGAACCACTAGTGTACGTATAAAAGAAAGAAAGCATTACCCAGTTAGACCAAGAACTACCACGACAAGTAAACTGTTTTTTTTTTTTTTTTT
TTGCTTTCGTGATTTGTAAAAATAAATAAACGGATCATTTCGAACATGTTGTCGAACGATCCCTCCCACGAATGAAGATTGTCGAGGCACTGTATTCCAA
GCGACAAACAGTAATTGAAACCCCTGCTACCTAATTTGCTCAAATCACTTATCTGTTTGCGCCATTTATTTTTATAAAATAAAATGAAGACAATATTTAG
CGAAGTATCGTCATAGAATAAAAAGAAGGAGCTGAACGCTGCAGCTCTTCAACTGGGACTACGGAACGAATACTCTTCTTTAATATTTGACTGAGAAAAT
TCTGATTGCGTAAGGAGATTTCGTTTCAGATAGAATTACATATTAATGCTGAGATAGCTTGGATTATCCGTGTTCACCTTAGACATTATCTATTCTATTA
GAACCAAATCCAAATCGCCTTTTCTACCTAGGATCAAATGAGCACAAAGAATGCCATGGCCATACGTAGAGCCCCGAATGATCGTAAATCTTCGTATTCT
TCAACCGGTAATAAAATCCGACTTGCGCTACTATAGTTCAGTGCATAGTTGACAATATCACATGGCACGAAAAAAGAGTGATCAGAATTGCAACAGTCAA
CGGACAAAAACAGTGCTTTTGATTGTCATTCAATTTCTTGATTGCTGACCGACAACAAATTCCTCGAATTGAATACTTCGAATTAACAACAGAAAGTTGT
ACGATAAAACACCACGCGAGAATAGTGGAACAAATAATTACGGTTGCCTCCGGTATACTCAAAACAAATTGAGCGAGGACTTTTTTCCTTACATCTTGGA
CGCAAGAACCGTTGCGAACGCCAATGCCTTCGCATGACCTTTAAAGATCTTACATGCGCCTTGTATGCATGACTATGGAGCACATCTAGTCGCCATGATT
TCC