Description :
From Genome Similarity Track
Location :
Scaffold_31:10691- 12352
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010630Similar to myoH: Myosin IH heavy chain (Dictyostelium discoideum)

Sequence
1661 bases(100 bases per row)
ACCAAACGATCCTTGTCAGTGGCGAGAGTGGCGCTGGAAAAACCGAGACGACCAAGTTTGTCATGAATTATTTAGCAGAATGCAGCGGCAACGGAGAAGT
GGCCGAGGGACCCGATGAACATTCACACAAAGGAGAAGGCATGAGCGGAAGTCAATTGATGAGCGCAAACCCGATCCTCGAGTCTTTTGGAAACGCGCGG
ACACTGCGGAATGACAACAGTAGTCGCTTTGGCAAATTCGTGCGGATGTACTTTGATTCGGTGAACCAGGACGCCAATGACGATGCGCTGGTGATGGTCG
GGACGTCTGTGGAAACGTATTTGCTCGAAAAAGTGCGCGTGATTCACCAGACCCAGGGAGAGCGGAATTATCACATTTTCTACGAACTGCTGGCAGGCGC
CGACGACGAGCTCAAAGCAAAGCTGCACCTGACAGGGTTCAAGGCAAAAGATTTCCAGTACGTGAAAGGAGGCAATTGCTTTCAGAGAAACGATGGCGTT
CAAGATGGGAAGCAGTTTCAGCGTGTACTGGAGTCAATGGACATTCTCGGGTTTACCCATGCAGAACAAGACAGCCTTTGGAAAACATTGAGTGTACTGT
TGCATCTCGGAAACATTGCCTTTCTCCCATCGACAGACGAGGATGATGAAGCCAATTCCAGTTCGCCAGCGCCATGCCGAATCTCTCCGAAGTCTCCGTC
TTCATTGCCAGCAGAGAAGCATTTAGAGATCGTCGCAGACTTGCTCGGTGTTGAGCACGATCAATTTCGGTCGGCGCTGACAGCAAGGAAAATCAACATT
AGTGGTGAATGCTTCCATGTGAATCTAAGTCAAGCGCAGTGTGGTGATGCGAGAGATGCGATGGCGCGCTCGCTGTACGGCTTCCTGTTCCAGTTCTTAG
TGAACAAAATTAATGTGCATTCGCCTCAGCAGCAGAAGTCTCCGTTCCAGTCGACAGGCTTCTCTGATGATGATGATGCGAGTTCCCTATTATGCATCGC
TGTACTTGATATTTTTGGGTTCGAAGAGTTTGAGGTGAACTTGTTTGAGCAGTTCTGTATCAATTATGCGAACGAGAAGCTCCAGTACCAGTTTATTCAA
GACATTCTGCTCACGGAACAACAAGCGCATATCCAGGAAGGGATCAAGTGGAACGCTGTGGACTATCAAGACAACTCGATGTGTCTTGAGATGCTTGAGC
AACGACCGAACGGTATCTTCTCGCTATTGGATGAAGAATGTATCATTCCGAAAGGCAGCGACCCTGGTTTTGCACGGAAGATGTACTTGCAATTGCAAAG
CAATAGCTACTTCAGTGCGTCCCGGAAGGACCAGGCCGACTTTTCATTCAACATTCATCACTACGCTGGCGAAGTGCGATACGATGTCCGCGGATTTTGT
GAAAAGAACAAAGATCAACCCAATGCAGAGCTATTCGGTGTGCTGAATGATTCTCGCGACGAGCATCTCTCAGAACTGTTTCGCGTGTTCATGGAGAATG
AATCGCAGCGGATGCAACAGCAGCAGGGACCGAAACTGCGGCGCCGGTCGTCTGTGATCGGTGCTGTCGGTATCGCGTCTCAATTCAAGCAGCAGCTAGC
GGGGCTGATTGAGGTTGTGCAGCAGACGCAGACTCATTATATTCGTTGTATCAAGCCCAAC