Description :
From Genome Similarity Track
Location :
Scaffold_584:10691- 12067
Transcript NameFunction/comments
Phymu_g10988phospholipid-transporting ATPase, putative

Sequence
1376 bases(100 bases per row)
TGGCGGACCGACTGAGCTCCATGAACTACAGTAACAGCGTGGATCTGTCGGACTTGATGCTCTTCGCGCTCTACCTCGTGTTCGTCATCACCTTCGGCGC
GTACGCGTGTTATTCTCTTCAGATCACCATGAGACGGGATTTCCTGCAAAGTAGATCCCTACtgatcgagcagaagcgtTCTACCCAGATTCTAAAGAAC
ATGCTACCCGAACACGTAGTACAGCGGATGCAGAAGGGCGACACGTTGATcagcgaggacgagcaggacgtgACGATCCTGTTCTGTGACATCGCCGACT
TTGCGTCGTTCGTGAACCGCTTCAGCCCTACCGAGGTAGTTTCTCTCCTGGACCGCGTGTACTCCCTGTTCGACCAGATCTGCCAGAAGCACGGCGTGCG
GAAGATGGAGACAGTGGGGAAGACGTATATGGCGTGTGCTGGGTTGCAGGGCAAAGACCAAGGAAGAGAAGCCGCTCTTCGTGCGGTGACTATGGCCTTG
GACATGTTGGCTTCTCTTGAAAAGTGTCGCGCTTCGAATGGCAACGGGATCAAACTACGTATTGGCGTCCACTCCGGTCGTGTGGTTAGTGGTTTAGTGg
ggatgaagaagcagcagttctcTCTATTCGGCGATACAGTCAACACGTCGTCCCGTATGCAGTCGACAGGGGTCACCGGTCGATGTCAGATCTCCCAAGT
CACTTACAAGAAACTCGCAGGCCATTTCAGCTTTGAAGAACGGCAAATCGACGTCAAAGGCAAAGGTAGTATGACGACGTACTTAGTGGGAGAACCGCTC
ACGGAAGTGGCGCAAATGGCGTGTCTCGGTCAACTCGAGTTCAGCTCCAAGCGGGACTCCGTGCTCGTGTCTTCGTCGGTCATCAATGTCCGTCGTCCTT
TTGAGCAGGACTTTTTAGCTCTTACTAGGAACAAAATTATCCATTCGGCCAGACAGCGGTGGAAGAAGTACGACCCggttcggctgctgcttggcaCTCC
ACCTGACTTGGCTTCATGGGGGGGAACGGACACCAGTGAGAGCGTAGAACAGCACATGCTGACGGAGATCCGACTGGTGAATATGTGCttcaaggacgac
gacatggagaacAAGTACCTTGAGAGCACTTTAGCTGACCGAGTGGAAGGAGCTCGTACTACCCTGCTCTCCCTTGCAGTCTACGCTTTTTTCACGTGTA
TGCGGGACCTTTTAGTGGAGATTTTCTCGGTCGTTAGCTCCTATACGCCGCAGAAGGAGATCTCAGCCACCATGTACGCCATTCTACTATTTATCCGCAG
TCCCTTCGTGATCGTGGCGATTCTCGTAGCTCGACGGGTGCGGGACGAGTTTGTGTTCTACTCGGAGCTCAAACTT