Description :
From Genome Similarity Track
Location :
Scaffold_2:1069025- 1070242
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000797Similar to Tmem70: Transmembrane protein 70%2C mitochondrial (Mus musculus)

Sequence
1217 bases(100 bases per row)
TTGACGAAGAGCTTGAAGCCGCGCGCTTGAGTTCGCTGGACGCAAAGCTCAAGGCCATGGAAGCAGAGGACGAGACGGGAACGCTGCAGCAGCTGAAAGC
AACGCTGCTCCAGGGGGATGACGACGCGTTGAAGAGACCGAAAAGCACTGGCAGCGACAACGGCGAAGACCACGACGCATACGGCAGCGACTTTGAGGAG
GAAGAGGTCGTGAGCGAAATCTCGGACGACGAGATCGGTTCCGTCTCGGATCTCTGCTCCGAGCAGGAGGAATCGGCGAGCAGCAGCGCATATAGCAACG
CTCCCACGCCCGTCTCTCAGCGTGCGCCGCCACCGTCGAAACTGGACGACGACAAAGCCGTGGATGGCGAGAACGCGCTCAACAGCTACGACTACATCGA
AGAAGTCGAGAAAGGATGGTGACCGACGTGCCAGTACCTAAGAGACAGACAAATTGCATCAGTGTTATCACCACCATAGAGACATCACAGGGCGTCATTT
CTTCCTCGTTCTATCGGCAGTGTCTTTGTATTCATTCGTTTGTCGTTTACTGCTCTTCGTCCTGTTCCTCTTCCCGTGGCGCCAATTTCTTGCCAATGAG
CTTCTCCGCGAGCGCGCGGTTTTCAAACTCCTCCGGGTGGATGAACAGGCTCTTGCCCTTGGCCTGGAACGAGAGCATCGGGTGCATCGAGGACGACGGC
GGCGCCACGTCCGAGAGCTTGAACGAGTGCTTTGTGAGCTGCGCGAAGAGCGTCACGGTCTCCACCGTTAGCTCCGGGTCGCTCGCGTCGTTGTCGCTGC
GCCACATGCGCATCACGTACGGCTTGAAGAGCACGTGGAAGAGCGATGTCGTGCCCAGTCCAAAGAGCTGCGCACAATCAATAAAATAAGGCGATATGAG
GACCACACAGTATGCGAATCAGCAGCAACCTTACAAGCAAAAACAGGATAACGTACCATGATCGTGCCGCACATTGCCCACTATATATTCCATATAACAA
CAGCATCCGCGTCAAGCTATTAGCATGCTGCCAGGTCCATACGCAACAACGATATAAGGAAAGGCGCCATTCATGCATGCGTACCTTGCCGACCATGGAC
GTCGACTGCTCGCTGATGAGGCAGAGCGTGGGCATGCCGATGGACGTGAGGATGCATGACGTGACAGACACGCCTTTCATAAGGCGCACGGCGCGCGCCA
TTGGGCCTTCGTACACC