Description :
From Genome Similarity Track
Location :
Scaffold_968:10690- 12198
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_968-snap-gene-0.5Gene of unknown function

Sequence
1508 bases(100 bases per row)
CCTCGTTTATAGCCAATCACGAAAGCAGTCGAATGAGACTGCTTTTGGAGGGAAAAACGCATTTTTGACTGAGCTTCTGTCAGAAAACCAGAATGGGTAC
ACAGTTGAACGCAAACACAGGTCAAATGTCGGTCGGTCAGATTCATTTTAAAAGCGTTGCGCTCTTGACGAAGAGTTGCTAATACGAAATATATCTTCCG
CGGCATATCTTCACCAACTGGCAACGATTTGGCATGGAGTTGACGAGCGCTTCAAGGTATGAAGCCGGCACAGCATCCCATGCCTTCTGCACGGCCTCTT
TGAGCGCGGAAATCGAATAGTACTGCCGTCCTCCGCCGTAGACACGATAAGTCATCCACCCCTAGAGGTTATCAATTGGGTTTAAGTCCGGAGACTTCAC
CGGCCACTTCATGACGGTGATGCTGTGGTCAGAAAGCCAGCGCTTTGTGGCCTACGAGGAGTGAGCTGGGGCGTTGTCGTGCTGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCCTTGGACCAATTCGCGGTCGTCTTGGCTTCGCGATCGTCAGTCCACTTCCTGCGCGCGGTCCGGTGGCGAGGCAGCAGCTCCGGTC
CAGCCCTGACCTTCTTGAACTTCAGCCACGGCACGTCCTGGCACATGCGCTGCACCGTTCGCACATTCACGTCGACTTCCAATGCGTGCTTGACGCTCTT
AGCGCTGGCGCCCTCCTCAGACATTGCACGAACGATCGCCCACTCCGTCACTTTCTTCGGCCTTCCGCGCCGCGATTGCTTCGCTGGCTGGTTGCGCGCC
TTGATAACCTTGTGGCACGCACCGATGGAGCGTTTTACCGCGTTAGATATCGCCAAGAGCGTCAAACCGGCGTCGTGGAGGACCAAAATGGACTTCCGTT
CCTCCAGCGACAGCTCCGATGCCCCCATGATACTCCCGACCACGAAAAAGGCCAAATAGATAGCAGAAAACGCAGTGATCATTAAAAAAAACCACCTGCT
AGCCTCTGAAACAGCAATCCGAACGGGTGGCTCAAATTTTCCCGGCAGTCATATAGATTTTAATATATTACCGGTGCTTGTCAAACCAGCTTTCTGACAG
TAGCTCAG