Description :
From Genome Similarity Track
Location :
Scaffold_2509:1069- 4922
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_2509-abinit-gene-0.6Conserved gene of unknown function

Sequence
3853 bases(100 bases per row)
CAAGTCTGTGAGAACCACGATTATTGTTCCCTCGTCAGGTGTAGTTATCCTTACCTGCGCTTAAACATGTCCCTTGCAAGTCCTCGGTATTGGCGGCGAA
CCTGCGTTGCAACATCAATTGTCAAGGTTATACTCGAACTCAATGAGCATATCGACACAAACCATGTTCGCCTCGTCAAACTTCGAGGCTTGTAATATCA
ATTCTGAGTAGGATAAGAATCATCATCAGCGGCGCAGAAGAAGTGGTGAATAGAGCAAACAACCGCACCCCCGATATCAATGCAATTGCTGACGCCTTTC
TGCATCTTCTCTTGACAGAGGTTCTTCATGAGTTCGACATCGGAGTCGCACATTCGCAGCCGGGTTGCGAGCTCACTCTTCACCTACAAGAATGATGTAA
GACTTTCATGGTTGTAGCACCGTGCGTTGAAAACGGACCAAGAAATCATTGTAGTCGCTCGCTGGTCCGCAGAGCGGTTTGATCCGTTCGACAACATCGA
GTATGCCACTCAAGCTTTCGCGACCGATCGAATCGAGGTTCACCATCTTTGAGCTCAAGGCTGCAAGCAGGCATTCGAGTTCACGGCCTGAGATCACACA
CTTCTCGCCGAAGAATCGTCGCGCCTCCTTCGCAACATCGGCAGCTCGAACAAATAAGAAGCCGTGGTTGCAGCTGCGTGCAACGTTGAAGCTATAGGCG
ACATCCCCATTAGCTCGCTGCAGAGTTTCCCCTCTGAGGATGTCGCGAATATCCACAGTACCTCATTGTATAGAACCACACGAAAGTAGTCTCTGACGCG
AAGCGTTCGACCTCAGTTGTGCTCAGCCGACATGCTGCGTTGAGGAACATGTCTGTGTACTTTTCCAAGTGACTGGCGTATGACGTGGGGGTTTCTGGTG
CACCATCACTTCTCGATGTCGCAGCTCGGAGAGCTAACTGTGCCGTATTTTGCAAAAGTTGACCAAGCGGAAGCTCTTCGATGACGGTGCTGCCGTCACT
GAGAACACCACAGAGATCATCCATGATCGCCAGTGTAAGATCTTCTCTCCCTGCGCAATTTGCTGCGTATCCGTAGGAGACAAGATCTTTAGCATCGAAG
TCGTCTCGCTCTCTCAGCTGCCGAAGAAGATCAGCCGCGGACGAACTTTTCGCATCGTCATCGCCCAAATATGCTTCGAAGACCGAAAGCATCGACGCCT
TCGAGGAATCCATCTCAAACGCTTCTTGGGCCCATCGCCTGCTGTCTGATTGCCGGTTCAGCTTGAGGCATGCCGCTGCAACAATGCTACGCGAATACCG
TCAGACCAAGTTGCACCTCGCTCACCGTACCAGATTCTCACCGCTTGAACACAGCAGCTTCTTGCGGCGAGGTAGCTTGCTGGATACCCAACTCAGCCCA
TGCGACACACTCCTAGAAGTGGCGTAAGTTATCGAGTTGACTTAACCACAATCTAAGCACTTACGTCATGCGCGTTATTGTTCAGCGCGGCTCCAGCAGC
GTCATGTATAGTTTGCCTCATTCGTGTGACTTGACCCTTGACTTGGCCTTGGTTATCTCTGCCACGGGATGAAGGTGTCAGATACGAAGAGCAGTGACAT
GGGTGCTGCTTACATACCGTGGCCATGCAGCTATCATTTCGCTGATTCGCTTCAGCTCAGCGATTGCTCGTGCACGATTTTGGGCTGAGTCGGATACTGC
TAGAGCGGACGCCAACTCGAGCCCAATGTCGAGCACATGATCACCGTAGTGACGCTCCAACTGTCGGTAAATCTGTATGGATTCGTCGCTGAAAGCGTTT
GCCTCGACAAACATCCTCGCACCAGCTAACGAGGCAGCAACATCATCGCGCTGAAACAAGTACTTCAGCATTAGACTGGCTTTGTCTTGATCTTGGGTGG
AGATGTATAACTTGGTCATCTTGAGCAAAGTTGCTGAGTCCTTGTTGTGGCCGAGTAGTGCGAAACAGGTCTCTGCCTTCTCGACTTCACCGAGCGACAC
AAGAGAACCCAGCAGTCGTCCCAGGAAGGAGAGTTTGTACGCCACCACGCACGATTCTTCGCCTCCGATATCTTGCGCTGTCTCTACTGCGTCGCAGAGT
CGTAGAGCTTCCTCAGCAAGAGTAACCAAGTCGACATGGCTTTCACTGCGGCTCCATTCGTCGAGTGCATCTTGAATAAGCTCCAATAGGCAACTCGTGT
TGCTCATCATGTACGGTAGCAGCATTTGGAGTTCGTGGAGAGTTTCAATCAGTATGGTCACAGCCATATTGTCGTGTGCGTACGACTGCATCAGCCGCAC
TGTTCGAATGCGGTCCACGCAGAAATCCCAAATGTCTTGGAGCACTTCCTCAAGTTCGATTCCGTCTTTGAATCGAGTGAGACACGACAGTCCAACTTGG
CCCCAAATCGTGCTCGCGTAATCAAGAGCTTCCTTGGCAAGGGTCAAGTACTCAAAGCACTTGTCACTGTCAGCTGCGGCCGTCTCCATCAGGAGTGATC
CCACACGTCCATAAGATCGAAGCACGTCCAAGCAATCGTCAATGAAGACGCTCTGGTCGCGCGCACTGTCTCCAGTTAAATCCTTGTCGCCGCGCTTTGA
GCACGCTAGCGCCAAACCCATCACTCGCGCAGCCATGAATCGCACGAAGAGGAGAGGAAGTCTTGCACCAGACGTGCCGTGTGACTCGCCGTCTTGCAGC
GTCGATTGGTAACTCTTGAACGCTGCCCGCGCCGCGTTGTACAAGACGATGCCCGCCTCCATCATCCTGTCTGCGGACAGTATGAGCACTCGCTGCGAGC
TCGCGTTGACCACCATCGAGTGGAGCAGTTTTGCATTCTCTTCCACCGTCTTGATCGTCGCTTGCACATTGCCGTCTCCGCCTTCTTCCTTCCGCTTCCG
AAGTGCCGATCCGACGGCATCGAGCGACTTGACCATCTTCTCCACGCACTCAACGATCGCTCCATTTTGCGCAGCGTCCATCGTGGGCAGGTCGCCGCTG
TCCGTGGGATTTCCCTTCTTCCTTGCCGCGCAGATTTCCCTTTGGCATTTCCCCGCCCCCAAGAGTCTTGGGAACGACCATCATTCCGCATGTGGCCCGA
CTTCAACTAATCGTTAAATCAGTACACCTCTCATAAGTGATATATACTGAGCGATTGGTTTGAAGAGGTATTTCGGTCCACAAAGGCGGCACACGTTCGA
GAAGTACGGCGTAGATGAACATGGGACGCGTCGTGCGCTGTGTCGCTGCGGCGACAATCGTCGTCGGACTCGCGCTCTGTGATGCTGCGCCGCGAGTGGA
TATCCGCGTTATCCCACGCCCCCGCCCTGAGCCAGAGACGCCGTTTCTGGGGCCCTTCCCCTACAGAGAGCCGTCCGATCCGACGGGTAACCAGAGCTTT
TGTTGGTGACCGCACGTGCATGGACACTCACTGCGTTTGAACCCCTCGTTTGCACAGGACCTTTTGCGTCATATGCGAGCTCGGCGGGATGTATCACCAA
CTTTCCCGGGGAGATCGAAGGAAAGAGGTTCGTAGGGAGTGCAGCGCTTGCTTCTGCCGTCACATAGATTGCACTGACTCGGGATGCCATTGCAGTGTGA
TGATCGACCTGTGCCACTTGAAGAATGTTACGTTCCTCGAAGTCCCTCCAGCCGTAGCGGACGTGACGGAGACGCTTGAAGCGGAGGGTGAAGCTGCGAA
GGGTGAAGCGGCGGCGGGTGAGGCGGTGACGAGTGAAAACTCGCCTACTCCAGTAGAGATAAGCCAGCCGCCACTGCTGCGGCGGCAGATTCTTGGGTAC
GAACCCCGCGCTTTGTCGTTCCGTCACAATTGCACGTTTTACCAGCATGGGTA