Description :
From Genome Similarity Track
Location :
Scaffold_157:106838- 109139
Sequence
2301 bases(100 bases per row)
ATTGATCCAATGATGTTTGTAGTATGCGCAAGTGCTGGATCTACAATGCTCCCGGTGGCTTGAAGTTGTCGGTATCGTTGGATGTGTTTGTTAAGATGAA
CATCTTTGTGCAGCTTGCGCATGGCCTTGAGGACATTTTGTGCTCCGTGGGATTTGATGTAGTGCTTGCCAAGAAACGAAAGTAACCACATCTAGCGACA
TCGCCAAACTCCAACACATCGTCTCGATACTGCGGATACTTCTCGTCAAGCACGAATCCATTAGCGAGAAACAGCTTCATAAATACAGCGACAAGTTTGG
AGGTAGATTTCTTGTGCTTGCTGGAGCAATCGAACGAATCCTAGAGGCGGGGTTCCTGGGTATATCAGGAGAACCATACGTCCTTTAGGTTTGTCGATGA
ACTCGTTCGGCGACGTTTGGCTGGTGGTTCTTTGCTTTTATCCTCACTTCTCTCTTGTCTAGTTTTTGGCTGTGCTTTGTTGTAGACCTCAGCTTCCATC
ATCGAGACGCGAGAGTCGAACCTTTGGGTGACCTTTATTAACTGTTTAATCAATGAAGCTTGATGAAAAAATGTTGGGTGCTTTTGATGTCGATGGTGCT
GTCTTGAGCCTTGATGAGATTTGGTTGCATACTTGTCTTTGTGTAGCAGTTTCGATGCGATGACCAATCTAGAAGATCGCTGACGGAGTGAACTTGCTGG
ATGAAGCACGCTTCCAAACGTGTGACTACAAGTCAGTATTTCTTGAGCTGCTTCAATGATGGATAATGAATCAGCAGGTAAATGATAAGCGTTTCAGTAA
CCCTTTTGTTCACGTTGTACTATGTAGTCGTGAGCCCGTGAGACGCATTGAAGAGCGCTGTCGCAACAGCTTTGATCTTTGTCTGCGTACCGAAATCGAA
GACGTCAAGTGATAGAAAAGATGCGTCGGTATCGAGGTGTCGCCCACTCAAGACCCGAGCAACCTTGTGGTCTTTGGACGCTGTATTAAAAACGTATGCG
AAGGCCTTATTCGTCGCTGTCATATTCCACGCCCCTCGGTCGAAGATACACTGTACACACAAGCCAGCCCCATTTACATGCTGCTCTTCTCTGCGCCGAA
AAGGGTGAGATGTCAAGCGCTCGGATACGCCATCTTTTGCCGCGACCCGATCAAGAACACGGTTAATGTAGCTGTGCACACCAGCAGCGGTGTCTGGGCT
GTTCTTGTTCTTAGCAGTGGTGGACGATGTATCCGGTGAAGACACCACAACCTCTGGGTGACCGAGCACATCGATGAGCGGAGTTGCTGGAGCTGACGAG
GACTGTGAAATACACGTCTGCTCAGGAAGTTGACTCAGCACAGATATAGCTGGCGATGAGTGGGTCACGAGGGCGAGCGCTATCGCAAGCAGAGGACATG
TGGTGAAGTCTTCGTCCGGATAGAGCGATAGACCTTGCTCTTCAGAAGTCTTGATGCGGATGAAACGGACGAAGAATATGTCGCCCAATCCGATAGACAG
GTTAGCCTTCCGCAGCATTGTGAGGTCTGATGTGCACCTGAAGAGGAACTAAAGCAGACACAACAGTGCCGCATCTTGGTAGTCAGCACTAGTAACCGCA
GTTGAATACAAGTACTCCATCACTTTCTTGAGAGCCGACTTTGTACATGCGGGGGCCTTATTCACAAACGACCCTGACTCACGCTTCATGTAATGGTGTT
CGAGCGTCTGTCCCTTCTTGAGAAAATACTTTCTAACCACTGCTCGATGCTGTGGAAACTGCTCCACCAACCAATTCTTGGCCTGTCGAAAGTACTGCAT
GACCAAGTGTCGAGCTAAGAGCTGTCCTTTTTGGCCCCTTTGAACGCGAGCTACATGCCGACCTTGTCCATCAAAGCTTTTAAGGCAAGAGGTGCTCTCT
CGTGATGCATGCACTGTTGCAGGAACTCCCAACTAACCTCTTCTCTTTCGAGAAATTTCAAAAATGAGCGCGTTGCGTTCTCACGGGCACGCTTCGTGTG
GCAGGTGCTAGGTCGGTCAGACTCATCTTCAACGGAGATGTTGAACCTTGGATGTTGTTTGTAAAATATGCGAATGACTTGGTGTTTGTATAATGATAGT
AATAACAGCACTGCTCTCTCCGACCTGATATGTCGGAGAGGTAGCTGCGAGAGCTTCACTTGTCCATCTACTCTCTGATTAGTTATAAATATAGCCTTTG
TCCGATTTGACTCGCTAATAAAGGTTTTATATCACCACGCTCACCCAATTGGTCAATTCGGTCAATACTTTTTTCAAGCGCGGTCGGAGTTTTAATGTTA
T