Description :
From Genome Similarity Track
Location :
scaffold_16:10680- 13749
Sequence
3069 bases(100 bases per row)
GCACCAGTGTTAATCAAAGCTGGTGGTGGTTTCTCAACCATTTACAAAGACCTCTTGGACTATCAAAGTCACACTTTTCCTGAGACGTCCATCACTCATA
gtggaaactgcatgtgcatcGTGCACATTGGGGCCAGAGTTCTCTCTATTCACAGCATCAACAGTTCTATATATGGACCCAGTTGGGAGCCCTGCCCCTA
TTGGTCGTCCCAATTTCTTACCCTTGCGACTTCCGCGGTTGATCGAACGAGAACCCCGTGTCTGTTGCCAACACTCTGCGGTTCCGGGAAACATGACTCA
GCTTCTCACAACGGAAGCACTTTCCATCGTTGCGAGGACGCTCATTTCCAGGCGTGGAAATGTACGAGAAGTCCATTGGTATTGGACCATCATATGTACC
GATCGACTGGCGCGCTTGCCTTGGTACGAAGCCATTGAAGTTGGTTTGCCTTATGCTGCACTATTCTTGCGTCGCACGGTTGATGGCATCGTCCAGGTCT
TGGGATACTCATGGAACAATTGATTCCGAATTAAACCATCTTTCAAGCCTACCATGAACGTTACAACTTGCGCTGAAACGTCAATTGGTTCGTTGACGAT
GCTTGATACCAAGTAGCGAGCACGCTGTGCATACGAGTGTAGGTCGTAACAACCGCTTCAAGAACTCGTCACGGGCACGAAGCTCACTCTGTGGTGGTTC
AAACGCCTTCTTTAGCTCGACTTTGAAGCGTTCGTAGCTAGAAAAGCAGTCTAGATCGTGTAAACGCTTCTTATACACCCAACTCTTCGCACGACCCGCA
AGGTTGGACATTGCACTTCCGGCAAGGGGTCTCGCAACTGtcttgcagtgattgctACATCCAACTCGACAAACCATCGTGAGAGAAGCTCGTTTATAAC
ACTTGCGGCAAGGGGTCTCGCAGTTGTCCtgcagtgattgctgcatccaACTCGACATCCCATCGTGATAGAGGCTCGTTCTCTCCACAACGGTAAAATG
ACAAGTTCGGATTCAGAGGCATCATTCTGTACGAAGCTATAGGGGATCCGACCTGTTTTCGAGATTCCATAATTTTAAGATGCATGTAACTGACGTCTGC
GTTCTTCTGGTCATCCGGAGAAGACGACCACAGTAAACTGACTACTACAGCTTCTCCGATGATTCTCGCATCCGCTTGAGTGCCATCCATTCATGTTGTT
ACGGGGTTACAGGTACCCTGGCGTGAAGgagcgggtcacacaagatagtgtgtCTACACAATGATgaggctacaccttaacacgAAACCATTacatggct
ggactgccagtagttatgcactttaattaggttttactatttaaaaaGGAAAACCTTTAAATTTGGAATAtatgcggctttgccgcaaataaaacaaata
aatgcagtttacattttgagcggaagaatTTATTTGCGTTGGGATAAGGTTgtcattactcttggagtcagcgtattgcaatccgctacactcgtactgg
ttcaaagtatagaacggaggtcggtggccttagcttagcttcctctacaaCAGTCCCCCTGCACCTGTGAAGACAACCAAGGAAACATCTCATTCGTGAA
CTCTTTCGTTTGCGGTACCGATGGACTGAGTGATACTCCaacctagctacatgcaagaCACCCAAAGGGCCCCTAAAAGGTTTTACTAATAAAACCTTAG
GCTCTTGATGAATGAATCAAGGGTATACTGAGGTTGAGCCTCAGATTCAATTgttacaagatcttgggtatacggagcttgaactttgaaAGCTTaagct
tcaactttcgtggaaGGTATCCAGTAAAAAGGGCTGGCTTACACCACTCACTTGTAAAGACAGACACACGTCgctctcgtcaccagtacaaatcCCCAGG
TAAGAACCAGCATTCGTGTAACAAACAGAACGTTTGTGACTCATGAAGATATGCATTTGGAAACACAATGCTATAATCTTCTTTTACCACTTCCCACAAT
GCTTACAAGAAGTACATAAATGTACTTTTAcgtaatggctaagtgtagcccattacatTTATTCCTAGATATTGCATGAAGTAGAATATCAGTATCTTTG
ACGTGAAATGTGGGAGCATATAACAAAAGAATTACAGTACATCGAATCCCACGTGTGACGCCATTGGATGACCTCACAAATGTCCTCTGAATAAATCAGT
ACAGAATGATGGTTCCTACTTAAGAATCTACACTGGCGTTGAGGCGACGTGTTTCTTCCATCTAAAGTGAGTGGAGCGAGTCAGTCACTTTGCGCGAGCT
CTCTACGAGGTCTTCATTTTCGAGTAGCCCACGCTTTAATCGCAGTGTAGGTTCAGGTTCCACAAGGCTCCCTTGGGTTCAACATCAGTGAGCCCAAGAA
TTTTTACATAAGGATCATAGGTGTTACTTCGTCATGTGTAGACCTTTTACATGTAACATTGAGGTACTATAGTGTTGTTGTTCATGTAGCTTTATGAACC
ATAATTTCTTTTCACTTCGGTGTCAATCTCACCGCAATTCTGTCAAGTCTTCCTCTTAATCACAAGCGCGCGTTCTGTTTAAATATCCTCTTCGAGCATT
ACACTGATCGCTTAATAGTGTTATTGCCGTGTGACGCACAATTTGAGTCCAGGAACCGATTCAAAGTCACGACCTGCTGTATGAGGATAATTCATGTCGA
GGATCTCTTGTCAAAATATTGTGACAGTTCCCAACGAATAAAAATCGGTAGTTTTTTAGGCAAACTGCCCCACTTATCGCAGTCAGTGTTGTTCACGTAT
CCTCTGAGACCGAATTACCCATGGCAGATGACGAGTTCAGCTCTTTCCCTGGTAATATCCAAGCCAATTTGATTTATACGAGGTACAAAAAAATGCAGTC
ATTTTCCAGTAGGCCGCCGTGCAGTTATTAAGACTAAATCATGGCATCGCTGACACTGAGCATCTAGGCCTAGAGGCCGAGACGGATAAAATCATTCTCG
AATGGAGagaagctgagatccattttcAAACGGAGCAGCAGGGCGTCGTACTACCAGTTTCCAAGCCAA