Description :
From Genome Similarity Track
Location :
Scaffold_2351:1068- 2899
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2351-snap-gene-0.2Conserved gene of unknown function

Sequence
1831 bases(100 bases per row)
GGACGCAGTCTTTGAAGCTTGGCGACGCTGGGTCGAGCTGGAAGCCGGTCGGAAGAAAGAGCTTGAGGTACACCACGATGAGCTTGGAGTCTGATCGCTT
CTGACGTTCGCTTGAGTCCCACACGGACGGCACCTTCGTGTACCATTCGTACCAGACAGTAGAAAGGCTGGTCGCGGCCGTTTCCTTCCTGCGTTTTGCT
TGTGGTTCCTTAGGCTCGCGCTCGTTCGGCTCAGTCTCTATGGCGCTGGTTGCGAGCTGCACAAGGGTGTGCGAGTCAGGAAGGCAAAGGAGAGCTGCTT
CACAGACGCGAAGCCGAGCCGACAGCTTTCGATTGAGCTCGATGAGCTGCTGGACCACAGCAGCATCGTGGTGAGCTTGCTGTTCTCGCGTCATATCCGC
CGCGCGTGAGCCATCTGCTGTCGCTGTGTTGCTTGTAGAGCCGTCGCCGCGAAGAGCCATCGACCACGCGAGCATTTCGCCCATCGGAATCCCTGCTTCG
CCAGCGCAGCCTTCCAGCTTGCGAACGATTGGTGCGTGCACGTTCAGCTCCTTCGCCAGCGGGAAATACATCACCAGGTACGCGGTCAAGACGTAGAGCA
TCTTCACCCCAACGTTTAGCCGTTCGTCAGCATGCCCAGTGCACGAGCCGAAGAGCAGAGACTGCAGCGTGGACAGCTTCGCTTGAGTTGTGTGGTCGAG
CGCCGCAACGTCTGCGATTGGAGGTATCGCGTCTGAAGCCTAGCCGCTCAGCACCCGCGCGACCTTCCTGTCTTCCCGCGGCGTATTGAAGACATACGCG
AAGCCTTTGTTTGTCGTGCTGAGGTTCCAAGCCCCGCGATCGAAGATCCACTGCGGCGCAAGCTTCTCGTCGCTGTTCGCGTGCTGCGCGCCTCCTCGGC
GAAACGAGTGGGAGGTGAGATCTTGCGTTGCTGTTGGTGGCAGCGTGATATACCGCAGTAGGTGGTTCACGTAGCCGTGTATGCCCATCTCTGCCGTCGC
CTTGCCCGCCTTTGCTGCCGTTGGAGCCGAAGCAGGAGATTGCGGCATCTCGACGTCGGCGTCGAGCGCCATCTGCAGCGGCGTCGCAGGATCTGCAGCG
ACAGCGGCGCGAGTGACGAGTGCTGGAAGCTGGCTGAGGAGCGACGCCGTCGGTCCGTCCTGCATCGCGATCGCCACGGCGAGCGCAAGAAGCGGGCAAG
TGAGGAAGTCGGCGCGGTCGGGCACAAGCGTGAGCCCTTGCTCTTGTGAGGTCTTCACGCGGAGGAGGCGAATGTAGAAGACGTCGGTCGAAGAGACGGA
GAGGTGCTGCTTCTGAACGAAGCCCAAGTCCGACGCACGCACGAAGCAGTGCCACATTAAGCACAGAAGCGCGGCATCCTGGTAGTCCTTCACGCTCGAC
GCGTTGCTAAGCACAGTGCGCATCAAAAGAGACAAATCCTCTTTCTTGCACGACGGTGCCTTGCTCACAAAGCCTCCCATCTCTCGCTTGAGGCAGTGCT
TCTCTAACGTTTTCCCTTTCTTCAGCAGCTCGCACTCCGTCGCCGCTCGTAGATGGGGGTACTGGCCGATCAACCAAAGCTTGACCTGCCGGTAGTACGA
CATGACAGAGTTCCTTGTCGACGGCGCTCCCTGCTTTCCTTCTTTGAACGCGAGATACAACCCGAACCTGTCTATCACAGTCACCAAGCGCGCACCAGTG
GCGTCGCTTTGGATGCTCGCATTGATGTAGTCCATGCTAACATCCTCCACCTTGAGGAAACGTATGAATGCGCTTACCGCGGTGGTGCGCGCACGCTGCG
TGTTGGCAGGGATCAGGGACTCCAGGCTCAT