Description :
From Genome Similarity Track
Location :
Scaffold_123:10679- 12151
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_123-fgenesh-gene-0.0Sodium/hydrogen exchanger

Sequence
1472 bases(100 bases per row)
ACAGCGAGCCAAGGACGTGGGGCTCGACCCGCAGATCATTTTCTTTGGGTTGCTGCCTCCGATCATTCTTGAAGCCGGATTCACAGTCAAGCACCGCGGG
TTCTTTGCCAACTTTTGGGACAGTTTTCTGCTGGGTATTGTGGGGACCGTGCTCTCGACCGTGGGCGTCGCGCTTGCGCTCTATTGGCTCGGGCGCTCGC
CACTCTTTGTCACGGCGCTGAGTCCGGCCGAGGCCATGCAGTACGGCTCGCTAATCTCGGCCATTGATCCGATCGCGTCGCAGCTCGTGCTGCGCAAGAG
TCACGTGCCGTCGTTGCTGCCTGAGCTCGTCTTTGGCGAACGCTCGCTCAACAATGCGATCAGTACGATGCGGCTTTTTGGATTTCTTCAACCGGAAATG
GATATCTAACCGAAACCCCAGCGGTGGCGATTTTCAACCTGTGCCAGGAACGAGTGCAGAGTGGCGACACGAGCATGTCGTTTAGCAACGGCATGCAAAT
GCTCGCCGAGCTCGCGGGCATCGGCGCCGGTTCTCTTGTGCTTGCGGCGGTGGTCNNNNNNNNNNATGGCTTGGATCTCTTCGACCGGAACTGGATAGCT
CACCAAAACCCCAGCCGTGGCGATTTTCAACCTGTGTCAGGAACGAGTGCAGAGTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCGTATACCTTCCAATTCCATAGTGGCCCTAGCTAATGCGGAGCAATTCGGTGTGCGTAGAACTCGGANNNNNNNNNNGGCTTACCTTCCA
ATTCTATAGAGGCTCTAGCTAATGCGAAGCTGTTCGGTGTGCGTAGAACTCGGACGATGCGCTCAAGCAGCACCCCACGTACGAAATTTCGATCCTGCTG
CTATTTGCCTACGCGTCGTACTTGGCCGGCGAGTTTGTCCACCTGAGCGGCCACGTGGCCGTGTTTTTCAGTGGCGCGTTCATCCGTCACTACCACATGC
ACAATGTCTCGCGTGCCAGCGCCACGACGTTCAAGCATTTGCTGCGCACCATGGCGTTTCTCGCCGAAAACTTCATCTTCATCTACCTCGGTTTGAGCCT
GTTTGCCTGTATGTTTTATGTGCAAGTGGACATCGGCTCAATTATAATTCTAACCCAATTAATACTGTTCGACTCCCAGACTCGGACACGTTCAAGTGGG
AGTGGCGATTCATCATTGGGAGCCTCGTCGTGTGCCTGATTATGCGCGCGTGTACAGTGTTTCCACTCTGCTACGTCGCCGGCCTCTGGCGTGTCCACGC
GATCCCCGTGCAGTACATGATCGTCATTTGGCTCTCGGGCCTGCGCGGCGCGATCGCGTTTGCGCTTTCGCTCAACGTACGGACGCTAGAAAGCGACCCC
TCGCACGCAGCGATCATCCGCAGCTCGACGCTGTTCACTGTGCTCTGCTCCACCATCGTACGTTCGTCTTGC