Description :
From Genome Similarity Track
Location :
Scaffold_349:10678- 13089
Sequence
2411 bases(100 bases per row)
ATTAACATAAAACGGTGTTTCACCCGTGCTGGCGTGAATACTACTGTTAATAGCAAACTCCGCGAACCACAAATGTTTACTACATTCCCTGGGAGTTGCT
ATTGTGCGCAAACATCCGCCACTACACTATTGACCCGTTTGGTCTTGCCATCGGTTTAAAGATGATCGGCGGTAGATATGTGGAGCTTGCTACCAAGCAC
CTTGAACACATGGTGCCAAAACCCTGACGCAAAACGTGGATCCCGGTCGCAACCATGGACTAGGGCAACTCGTGTAGTCGACACACATGATCCAGGAACA
AGAAAGCTGCCTCCTTGCCTAATATCTTTGTGCGAAACGATGCTAAGTGCACCGTTTTGATCAGTTTGTCATCAAAGACGACGAGTTTAGTCCTGCCTTG
ATGTCCAGGCGGCATACCTAACATGAAATCCAAACTGACCGACTTCCATCAATCAGTAGGTATTGGCAGCGGCTTTAGTGGCGAACTTCTTGAAGGTGCC
GGATTTACAAGCTGACTCTCTTTGCGCAATCGAATACAATGAGCTCCCACCATAATAGTTGTGGCTACCAAAATTCATCTGTCACTCGTCAGAATGTCGT
CTCACGGCCCAGATGACACCTTGATGGTGCATAATTGAGCTCGTGCATAATCTTCTGTTTGAGATCTGTTTCATTGGGGAGATAGATTCGAATTGGATCA
CAAGATGACGGTTGATGCCGTCACGGACAATCAATATAACTAAAACGGTTAAGCTTCACTTTTAGGTGCGACAAAAGAGTAACCTTTCGCCCACCAAAGT
GATCTATATGCAGACGACAATGTTCGTCCTGCTTGTAGCTCTTCTTTATATCAGAGGCCAGATTGTTTGTCACATGGTCAACCCTTAGGGCTGCAAGTGT
CGACGACTCAATTCGTGCTTTAGCACGAGACACGTCTTCAACGTGTCGTTTCTTAAAGTCTGGTCTGCCCGATAACGCATCAGCCAATACATTCTACTTC
CCCGTCTTGAATTTAACTCGAAAATTACATTCTGAGAAGAATGTGAGGCACCTCGCCATCCTTGATGAAGGTGCAGCGAGTTTATCGCGGTTCGCAATGA
TGCGTGATCTATGTAAATTACAAAAGGTTCAGTGCCCAATAGAATGCACTCGTAACTTCAAAAGAGCATACTTTATACGAAGTAGCTCGTTTTCCTGCAC
GGGGTAATTTAGCTCTGAGGTGTTTAAAAGCCGAGACTGATACGAGATGACACAATCAATGATGCCATCATCTTTTGCATAATTGCACAGCCGATAGTTA
AATTACTCCCATCGCAGACAACGCTAAAGGGATTATACGCGTCTGGCAAATCCAAGACCAGAGCATCTACAATTGATTGCTTTACTGAAGTGAAAGCATT
TACTTAAGCTTCAGACCAATTTCACTCTGTGTCCTTTTTTTTAAAACGATCAGACGTAGGTTCGGTTCGCTCTGCATTATTATTGCTGTATTTATACAAG
CAATTGGCAAGCCCGAGGAATTGACGCACATCCTTCACATGTCGTGGACAGGCCATTCCTTTATAGCTGTAATTTTTCCTGAATCTGCTCTGACACCGTG
TTTTCCCACGATGCATCCTAGTACAGGTATTTCGGGGACCCCTAAGACTCACTTGTGCAACTTGACGTACGATTGGGTGTCACCTAGAGTCTGCAACACA
ACCTCCAAATGCCATTTGTGCAATTCCATCTCACTCAATCCGTCCTCGGCCCTACTATGGTCGAATACATCGTCAAAGTAATGAGGAACACATCGTCAAA
GTAATTAGGTGCGTAACCACGCATCACATGAGATACCACCTGGTTGAATGCCACTGGTGCGTTTTTCAACTCTTGTGGCATCACTAGCCCCCCCCACAGT
ATACTGCTGAGGGTGATAACTGCCGTATTAGCTACATTGCTCTCATTCATGAGTACCTGATAGTAGACATACGTCCAATGTAATGCGGAAACGATAGTTG
AATACTTCATTAAGTTCAAAAGGTAATCTATCCGCGGGATCGGTGTTTGCGCAAGGATGGTGGTCTTGTTCAACTTTTTGTAAGCATGAACTACACGACA
ATTGCCTGTTGCTTTACGCACACAGAAGTTCAGGCTGCAGTGGGGCGACTTGGTTTCACGTACATGTCCCGCCTTGAATCGCTTGTCGAAGAATTGGTCG
ATGGAGTCGACCTATTCCTTCGGCAATAGCCACTACCTGGTCACATAGTACTTGGTTCCATGTTCTAAGTCAATATCGTGCCTGATACCCCTATCGGCCG
GTAGGCGGTTCGGGAATTCTGAAGGAAAGACACCACGGTGCTTCCACAGAACTTTGTACAACGGTGTGCTTTCTGGGCGTCCTATCCTTGAGCAGAAAAT
TGTTTAGTCTT