Description :
From Genome Similarity Track
Location :
Scaffold_377:10671- 31267
Transcript NameFunction/comments
g15917.t1hypothetical protein
g15918.t1hypothetical protein
g15919.t1hypothetical protein
g15920.t1hypothetical protein

Sequence
20596 bases(100 bases per row)
AGATCGAGGTGTTCTGCACCCAGGCGACGAGCGACAGCAACCAGGCTATGGATGCCTTGCGTCAGCTCCGCCAAGATCACGTGGCTCTCACCCGGCACCA
CAACGCCGCTAATGCTGCCCTCGGGCACCATGCTGACATTGTGGCAGGCTTGTCGGCTCGCGCCAAAGCTGCCGAGGCTTCGGCGGCGGCTGCTCAGCGA
CTGATCCGGAAGGATCGGGAGCGATTTAAAGCTGGCCTCGTCGCCTACACGGCGCAGCTGGCCAAGCTTCGGAGCGACCTCGCCGCGTCTGCTCAAGCCT
CTGCGGGTGCGGTTCCGGCTCAGCTCCAGGCTCAGCAAGAGGAAAATGCGAGCCTGAAGCGAGCCATCTCCGTCTTGCGCCGTCACTCGGCTGTCCACGA
CTTGGACGTGGATACCTTGGTCCTTGCCTCTGCTGGTAAGTCTTCAGTCTCCACTTGTTCGGTCGTCTCTCATCCTCTAACTCTTCATGTTTCCTCTGTC
AGGTATCACCGCAGGAGACATTGACTGGGACTTGCTCGGGCTGTCGCCTCCGAGCATTTGCTCCAAGCGTAGCCGGAGTTCGTCCTCCGAGAGTTCGGAG
GACAGCCCGGAGGCTGCCGTGGACTCTGGCGACGAAGCCAAGGCCCCAGCCGAGGAGTCTGTCGGCGCCGGGGATGACAGCGAGGAGTCGGACGACTTGC
CGCTCATCCCCTCGGTCTCCAGGCGTCGGCGTGACCGGCGCAAGCGTCTCCGACAGCGCAGCTCTTCTCCGAGCTTACTGTCGAAGTCAGCTCTTCCCGC
TGGCAAGCGGTTGGGCCGACCGTCGGTCAACCTTCGAGCTCGCGCTCAAGGTGGACCCTCGGGCGCCTCTGGGTCGACTCCAGTGTCATCTCCCGTGTCT
GGGTCGACCCCCACACCCTCACCGAGTCTTTCGGCGGGGCCGTCACCCGGTTCTTCGGCGCATACGCCTGCCCCGGATTCTTCGGTGCCTCCATCTTTGG
CCGAAGTCGTTGACTTGTCGGGGGAGGAGGTCGTCACCGAAGCTCCGGCGGCTGCGGTTCCTGCGTCCGGGCCATTTTCGTCGCCGGTGATTACTCCACC
GCGGCATGACGGTCGCCCGTCGCGCAGTGCCTCGGTGCTGGCCAATTTGCGCTTGATGAAGGCTCTGGAGACTCTGGAGGCTTCGGATGACTTCATTCTC
GGCTCTGGCCAGTCGTCCGAGGTTCCCAAGGTCTCCTCACCTTCGGTGGCTCCCACCAGTGGTGGTGTTGTCGCCCCGATTCCCGCCGTTGGCGTTGAGT
CTTCGCCTGCCGTTTTGGTGACCTCGGTCGGCCCACCAGTTTCGGCGCCACCCTCGGTCTCGTCGGTTCCACCACCGGCGACTCCGGTTGGGTCGGCTGC
GGGTGCCCCAGAGATTTCTGCAGCGTCGGCTAGCCAGCCACGCGCACGTCTTTCGGCGGCTCGGTCTGCGACGACACCGAGGTCACGGCCACGCTGTCGA
CCGCCCCAGGCACGGACCCGAACTCGTTCGCTCCGGCCGTGCCGACGGTCCCCGGGAGCGTGGATTCCCAGCGTCTGTCGATGCTGGCGAACCCGTTCTT
GACCCCTGGGTTCACGGCACCAGGCGCACAAACTGCCTGGTGCCAGATCCAGAACCAGAGCGTGACTCCGCCTATTGCAAAGGGCGTCGAGTCCCCGTGT
TCGGTTGCTGGGATCCGGGCCCTGGCGGATTGGACTAATCCGGCTCATCCGTGGCAGCAAGTGCGCCAGAAGATGCCGGAGGTCCCTTGCTTGTTCGGGC
TGGACCAGAATCCGCCGGGGTCCAAGATTTCGATTCGCGCAAGTGGGTTGGCGCGCACAGTGAAAATGTGGCGCCAATTCCAAGGCGTCTCGACCGACCG
GACGGAGAAAGCAGACCTCGGTCTCGCTTTGTGGGAGCGGCGCCACTGGGTCCAGGTAGCTGCCGTTGAGACTTTTCTCCGGAGCGAGGCACAGAGACTT
GGAGCGACCGATCCGTCGGTCGTCGCCTCCGTGCCGCCTGGACCGAGTACAACAAGGCCCGTAACCTCCGTGCTGATCGCATTCGGCAACAGATGCTTTA
CCGCTGTTGGGAATGGTGCATTGAACGCACTGGCAAGCCTCGGGAGTCGATCACCGAGTTCTTGCTGGAGCCCACGTACCTCCAATATTCGTTCGAGGTA
ATTGAGTGGGCTCCGGCGTCAGAAGATTGGCTCGGAGAGCTCGCCACGTTGGACGACAGGCAGCCGTGGCGCAATTGTTGGGTCGACGCGCCGGCTAGCC
ACCCGTTCAACACCACGTTCGCCCCATGCAACCCTCAGGTGCCAATGTTCGTGCCCCGAGGGATGACGCAAGCGGAGGTGGTGTCGGGTTTGATGGTGGA
TCCTTCGTTGCCGTCGGCGTCGGTGACGGCTCCATGGGCTGCCCAGGCTTCTGTCGGTGGTGCTCCCGACCAACCGAGCCAGGAGGAAGCCAATGAAGAC
GTCTCCGAATCTTCGCCTGGCCACTCCACGGTTCCAGCACCGACCAACACGTCGGCCGCTCCCCAAGGGTCAGACCTGGATGTTTTGGCTAACATCGCGT
CGACCACTGAGGTCTAGGCTTCGGTCTGGTCTCACTCATTTTCTCCGTTCGTTCCTCAAGCTGCTAGTGTGCCGTCCGAAGCCCGTAGTCATCCGTAGTG
GCAGTTCTTGAGCTCCAAGTAATTCCATTTAATCCAATTCCATTCGAAAATCGTTCACGTCACATGTAAATATGCAAATTCGATGCAGTAGCGGGTTTCG
TCTGTCACTGCGGGCTGCATCATCCCCGCAGGCAGTTCATTCGTCAACCGACGTCGCAACCAGGCCTCGTCAGAGTCTTGGTAGCAATCAATAGTCGGTC
ACTCGCAATTTTGATACAGTAGCAAATTCCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCA
TCAGCAACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGGGTCCGCAGATAATCATAAAGTAGCCCGCCACATGACAAATTTGAGGCAGGTTCCCACG
TGGGTTCATCATACCCACTCCACTTCACCTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTC
ATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCATCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGA
CTCTTCGGTCGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGT
ACGCGAACTCTTCGATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCA
AACTCTGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGGTCAGACGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCA
TCGATATTCGGTACTGCAGCTCTCTCACGTCGCTCCAACGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTT
TCCACGAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCTAATGCGTCAGTCTGGCTTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAG
CGTGGATTATGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATC
TCGTCCCAGTCTTGCTGTAGCGGGTCTTCTGCGTACACCCGCACTGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGAT
AGCTCAGTGTCGCTCTTGACCGAGACTGCATCATCTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATTAGAGTTGG
TGCTCCGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCG
CACTGGAACAGTAGTAGGGCTGAGTTGCCTCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACAT
TTCCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCGATCCA
AAAATAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTT
GTGGGCACAACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGCTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGA
ACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTC
ATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTACCTCATTGCTCGAT
TGCTCGGCTCTCAGCTCACCCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAA
ACTGGACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGA
GATTCCACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTC
AGCTCGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAACT
CTCGGACCACGTGCAAATACTTCACTGACCGCAGCTTGGTCGTGAGCTCTCGGTGACGATTCAGTTGTACCATCAGAGACTCCTTTCGACATGCCATCAC
CCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCA
TACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCATGAGCAACTGCCGT
ATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACCAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACG
AGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTG
CAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCC
ATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTC
GGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACTGGGTGCAACTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAAT
GCCCACTCATTCGCGAATAGCGTGATATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCTTCTGCAACCTTCTGTTGGAGCGCCGCGAAGC
TTCGTTTGGCCGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAATTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACT
GTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCCTTTTTCGAAGCAGGGAATGGCAGCTCTGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATA
CCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGA
GCAGTCGGTCTAACGTCTCCAGGCACGCATCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGA
TTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACTGAGGATTCGTGGTCGGCTTCGAAT
TTGGTCGGCGGAGTTGCGGACTCTTCAGGTGACCGCGATGAAGGGTCGGTCACCCCTGTCCGTGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGTT
CCGAGAAGTGGAGCCAGCCGCCTTTCGGTTGGACAAAACCCCACAGAGCATTGTCGATCATTCGTTGGTAAATCATCGGTGCGTTCTTCAATCCAAACGG
CATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGATACTTTGCGAGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCA
AGCGAGCAGAACCATAAGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACCAACGGCATGGCGTACTCCATAATCGCCGTAACTGCATTCACCAGCTTGT
AGTCGATGCACAACCGAATATCGACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGGCGAGCTTTCAG
CAAGCCTTTCAGGAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGCGGATGCCCCTGTACGTCAATATCGCAC
ACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTG
TCGCGCTCGGGTTCAGTTCATTCTCGGCTCTGGCCAGTCGTCCGAGGTTCCCGAGGTCTCCTCACCTTCGGTGGCTCCCACCAGTGGTGGTGTTGTTGCC
CCGATTCCAGCCGTTGGCGTTGAGTCGTCGCCTGCCGTTCTGGTGACCTCGGTCGGCCCGCCAGTTTCGGCGCCACCCTCGGTCTCGTCGGTTCCACCAC
CGGCGACTCCGGTTGGGTCGGCTGCGGGTGCCCCAGAGATTTCTGCAGCGTCGGCTAGCCAGCCACGCGCACGTCTTTCGGCGGCTCGGTCTGCGACGCG
TCGCGCGCACACCGAGGTCACGGCCACGCTGTCGACCGCTCCAGGCACGGACCCGAACTCGTTCGCTCCGGCCGTGCCGACGGTCCCCGGGAGCGTGGAT
TCCCAGCGTCTGTCGATGCTGGCGAACCCGTTCTTGACCCCTGGGTTCACGGCACCAGGCGCACAAACTGCCTGGTGCCAAATCCAGAACCAGAGCGTGA
CTCCACCCATCGCAAAGGGTGTCGAGTCCCCATGCTCGGTCGCTGGGATCCGGGCTCTGGCTGATTGGACCGACCCGGCCCATCCCTGGCAGCAAGTGCG
CCAGAGGATGCCGGAGGTCCCTTGCTTGTTCGGTCTGGACCAAAATCCGCCAGGGTCCAAGATCTCAATTCGCGCAAGTGGGTTGGCGCGCACAGTGAAA
ATGTGGCGCCAATTCCAAGGCGTCTCGACCGATCGGGCGGAGAAAGCAGACCTCGGTCTCGCTTTGTGGGAGCGGCGCCACTGGGTCCAGGTAGCTGCCG
TTGAGACTTTTCTCCGGAGCGAGGCACAGAGACTTGGGGTGACCGATCCATCGGTCGTTGCTCTCCGTGCCGCCTGGACCGAGTACAACAAAGCTCGCAA
CCTCCGTGCCGACCGCATCCGCCAACAGATGCTGTACCGCTGTTGGGAGTGGTGCATTGAACGCACTGGCAAGCCTCGGGAGTCGATCACCGAGTTCTTG
CTGGAGCCCACGTACCTCCAATATTCGTTCGAGGTAATTGAGTGGGCTCCGGCGTCAGAGGATTGGCTCGGTGAATTGGCTACGTTGGATGACAGGCAAC
CGTGGCGCAATTGTTGGGTCGACGCGCCGGCTAGCCACCCTTTTAACACCACGTTTGCTCCGTGCAACCCCCAAGTGCCTTTGTTCGTGCCTCGGGGGAT
GACGCAAGCGGAGGTGGTGTTTGGGTTGATGGTGGATCCATCCTTGTCGTCGGCTATGGTGACAGCCCCATGGGCTGCCCAGGCTTCTGTCGGTGGTGCT
CCCGACCAACCGAGCCAGGAGGAAGCCAATGAAGACGTCTCCGAATCTTCGCCTGGCCACTCCACGGTTCCAGCACCGACCAACACGTCGGCCGCTCCCC
AAGGGTCAGACCTGGATGTTTTGGCCAACCTCGCGTCTACCACTGAGGTCTAGGCTTCGGTCAGGCCCCCTCCAATTTTCACGTTCGTTTCTCAAGCTGC
CAGTGTGCCGTCCGAAGCCCGTAGTCATCCGTAGCGGCAGTTCTTGAGCTCCAAGTAATTCCATTTAATCCAATTCCATTCGAAAATCGTTCACGTCACA
TGTAAATATGCAAATTCGATGCAGTAGCGGGTTTCGTCTGTCACTGCGGGCTGCATCATCCCCACAGGCAGTTCATTCGTCAACCGACGTCGCAACCAGG
CCTCGTCAGAGTCTTGGTAGCAATCAATAGTCGGTCACTCGCAATTTTGATACAGTAGCAAATTCCATCTGTTGCTACGGGCTGTATCACCCCCGTAGAC
AGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGCGACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTA
GCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGCTCATCATACCCAATCCACTTCACTTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGA
CAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCATCGAAGTCC
AGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTTCGGTCGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGA
ACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCGAACTCTTCGATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGAGCGAGTTTCTT
GGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTCTGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGGTCAGACGTTGCCCCC
GTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCATCGATATTCGGTACTGCAGCTCTCTCACGTCGCTCCAACGACTCATTGTGTTCTCTCGCCCTCC
GAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCTAATGCGTCAGTCTGGCTTCC
GAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTATGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGA
GAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAGTCTTGCTGTAGCGGGTCTTCTGCGTACACCCGCACTGATTGCATGACCGTCTTCA
CCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGTGTCGCTCTTGACCGAGACTGCATCATCTCTGCAAAGGCCTGGAACACCTCGCTCAT
GAAGCGAGGGTCTCGGTCATGTCGGATTAGAGTTGGTGCTCCGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCT
GACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAACAGTAATAGAGCTGAGTTGCCTCGACGAGACTTCGGTAACGGTATGACGAAATCCA
TCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTT
GACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAG
TCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGCTC
CAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCG
GAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCT
GCGTTTGGAGCGCCAGGGTCTACCTCATTGCTCGATTGCTCGGCTCTCAGCTCACCCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTG
TACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTC
GTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGT
ACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAG
CCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAACTCTCGGACCACGTGCAAATACTTCACTGACCGCAGCTTGGTCGTGAGCTCTCGGTGACGATTCAG
TTGTACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGT
TCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATT
CTGGTAATTTCCACAAAATCCATGAGCAACTGCCGTATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACCAATCCGGTATAGGACCT
CGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCACGAAG
CTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGG
TCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACAC
TTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGGATGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACTGGGTGCAAC
TTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCGAATAGCGTGATATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCG
GTGCTTCTGCAACCTTCTGTTGGAGCGCCGCGAAGCTTCGTTTGGCCGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAATTGGTACAAAGC
TGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCCTTTTTCGAAGCAGGGAATGGCAGCTCT
GTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAA
AGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTCGGTCTAACGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATGTCATCGAC
AAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCG
TCAAGCGTGACTGAGGATTCGTGGTCGGCTTCGAATTTGGTCGGCGGAGTTGCGGACTCTTCAGGTGACCGCGATGAAGGGTCGGTCACCCCTGTCCGTG
CAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGTTCCGAGAAGTGGAGCCAGCCGCCTTTCGGTTGGACAAAACCCCACAGAGCATTGTCGATCATTCG
TTGGTAAATCATCGGTGCGTTCTTCAATCCAAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGATACTTTGCGAGCCCGCATC
GTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGCGAGCAGAACCATAAGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACCAACGGCATGGCGT
ACTCCATAATCGCCGTAACTGCATTCACCAGCTTGTAGTCGATGCACAACCGAATATCGACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCA
TGGGCTGTCCGAAAACGCCACTAGGCGAGCTTTCAGCAAGCCTTTCAGGAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGT
TTGATGGGCGGATGCCCCTGTACGTCAATATCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTT
TCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCGCTCGGGTTCAGTTCATTCTCGGCTCTGGCCAGTCGTCCGAGGTTCCCGAGGTCTCCTCA
CCTTCGGTGGCTCCCACCAGTGGTGGTGTTGTTGCCCCGATTCCAGCCGTTGGCGTTGAGTCGTCGCCTGCCGTTCTGGTGACCTCGGTCGGCCCGCCAG
TTTCGGCGCCACCCTCGGTCTCGTCGGTTCCACCACCGGCGACTCCGGTTGGGTCGGCTGCGGGTGCCCCAGAGATTTCTGCAGCGTCGGCTAGCCAGCC
ACGCGCACGTCTTTCGGCGGCTCGGTCTGCGACGCGTCGCGCGCACACCGAGGTCACGGCCACGCTGTCGACCGCTCCAGGCACGGACCCGAACTCGTTC
GCTCCGGCCGTGCCGACGGTCCCCGGGAGCGTGGATTCCCAGCGTCTTTCGATGCTGGCGAACCCGTTCTTGACCCCTGGGTTCACGGCACCAGGCGCAC
AAACTGCCTGGTGCCAGATCCAGAACCAGAGCGTGACTCCGCCTATTGCAAAGGGCGTCGAGTCCCCGTGTTCGGTTGCTGGGATCCGGGCCCTGGCTGA
TTGGACTAATCCGGCTCATCCGTGGCAGCAAGTGCGCCAGAAGATGCCGGAGGTCCCTTGCTTGTTCGGGCTGGACCAGAATCCGCCGGGGTCCAAGATT
TCGATTCGCGCAAGTGGGTTGGCGCGCACAGTGAAAATGTGGCGCCAATTCCAAGGCGTCTCGACCGACCGGACGGAGAAAGCAGACCTCGGTCTTGCTT
TGTGGGAGCGGCGCCACTGGGTCCAGGTAGCTGCCGTTGAGACTTTTCTCCGGAGCGAGGCACAGAGGCTTGGAGCGACCGATCCGTCGGTCGTCACCCT
CCGTGCCGCCTGGACTGAGTACAACAAGGCCCGTAACCTCCGTGCTGATCGCATTCGCCAACAGATGCTTTACCGCTGTTGGGAATGGTGCATCGAGCGT
ACCGGCAAGCCTCGGGAGTCGATCACCGAGTTCCTGCTGGAGCCCACGTACCTCCAATATTCGTTCGAGGTAATTGAGTGGGCTCCGGCGTCAGAAGATT
GGCTCGGAGAGCTCGCCACGTTGGATGACAGGCAGCCGTGGCGCAATTGTTGGGTCGACGCGCCGGCTAGCCACCCGTTCAACACCACGTTCGCCCCATG
CAACCCTCAGGTGCCAATGTTCATGCCCCGAGGGTTGACTCAGGCGGAGGTGGTGTCGGGTTTGATGGTGGATCCTTCGTTGCCGTCGGCGTCGGTGACG
GCTCCATGAGCTGCCCAAGCTTCTGTCGGTGGTGCTCCCGACCAACCGAGCCAGGAGGAAGCCAATGAAGACGTCTCCGAATCTTCGCCTGGCCACTCCA
CGGTTCCAGCACCGACCAACACGTCGGCCGCTCCCCAAGGGTCAGACCTGGATGTTTTGGCTAACATCGCGTCGACCACTGAGGTCTAGGCTTCGGTCTG
GTCTCACTCATTTTCTCCGTTCGTTCCTCAAGCTGCTAGTGTGCCGTCCGAAGCCCGTAGTCATCCGTAGTGGCAGTTCTTGAGCTCCAAGTAATTCCAT
TTAATCCAATTCCATTCGAAAATCGTTCACGTCACATGTAAATATGCAAATTCGATGCAGTAGCGGGTTTCGTCTGTCACTGCGGGCTGCATCATCCCCG
CAGGCAGTTCATTCGTCAACCGACGTCGCAACCAGGCCTCGTCAGAGTCTTGGTAGCAATCAATAGTCGGTCACTCGCAATTTTGATACAGTAGCAAATT
TCATCTGTTGCTACGGGCTGTATCACTCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGCGACTTCAACCATCTGCAATCGTC
GTTCACTGCGCCGGGTCCGCAGATAATCATACAGTAACCCGCCACATGATAAATTTGAGGCAGGTTCCCACGTGGGTTCATCATACCCAATCCACTTCAC
CTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATTCGCCAGCGAGCTGATCCGGCTCC
CAGCTATCTTCAGGCAACAACTCGTCGTCGAAGTCCAATCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTTCGGTCGGTCTCCGAATTCGTTGA
TGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCGAACTCTTCGATCTTTTTCTTGAT
CCTGAATGGCCCATGCCATCGGTGAGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTCTACTTCCGGGCGGAACAGAGACC
TCGGTCCTTCGACAGTGGGATCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCGTCGACATTCGGTACTGCAGCTCTCTCACG
TCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCCTTCTCAACACTTTGGTACTCCATTGCCATTTTCCACGAGATTTCCTGTTGCCGGTTCACT
TCTCGGCGCCATGCCAATGCGTCAGTCTGGCCACCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTGTGCGTCCCACCCATGAACTA
GGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATTAATCGCTCCGCGATCTCGTCCCAGTCTTGCTGTAGCGGGTCTTC
TGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGGTCGCTCTTGACCGAGACTGC
ATCATCTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATTAGAGTTGGTGCTCCGAATCTTCGGTACACGCATTCCT
CGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAACAGTAATAGAGCTGAGTTGCC
TCGACGGGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTGGCGAATAGCCTCGGAACTGTGGT
CGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCGATTTGACTCGGTGGTAAGTTCGACCGATACCTTG
GTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCACAACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTG
CCCCACCGACGGTTCGCTCCAAGAAAATACAGTACACCATCCTCGACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTC
CTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCA
ACGTCTTCTGCGTTTGGAGCGCCAGGGTCTACCTCGTTGCTCGATTGCTCGGCTCTCAGCTCACCCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTC
GCTCAGCCGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTA
GTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTACTTGGGCTCGGGCGAAGATGACTGTCGGTTTCTCTTCGGCC
GTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTCTAATTTCCTAGCCTCAGTCGAAGCTACGCTGGATTCTTTGC
TGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGACCACGTGCAGGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTG
ACGATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTTGAGTCTCCCACGATGACTAAATCCTCG
GCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTTACTGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTA
CAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCATATCCCCCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGT
ATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAAC
TCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAATGTACAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCG
CAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGA
GTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGGATGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACT
GGGTGCAACTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCGAATAGCGTGATATGCACCTCCTTGTCTCGGTCAAAGTGCC
GGAGGATCGGTGCTTCTGCAACCTTCTGTTGGAGCGCCGCGAAGCTTCGTTTGGCCGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAATTG
GTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCCTTTTTCGAAGCAGGGAAT
GGCAGCTCTGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATAC
TCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTCGGTCTAACGTCTCCAGGCACGCATCGAAAGTCTCGGACCCAAAACAGAT
GTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCA
TTCACTGCGTCAAGCGTGACTGAGGATTCGTGGTCGGCTTCGAATTTGGTCGGCGGAGTTGCGGACTCTTCAGGTGACCGCGATGAAGGGTCGGTCACCC
CTGTCCGTGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGTTCCGAGAAGTGGAGCCAGCCGCCTTTCGGTTGGACAAAACCCCACAGAGCATTGTC
GATCATTCGTTGGTAAATCATCGGTGCGTTCTTCAATCCAAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGATACTTTGCGA
GCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGCGAGCAGAACCATAAGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACCAACG
GCATGGCGTACTCCATAATCGCCGTGACTGCATTCACCAGCTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGG
CGACGCCCATGGGCTGTCCAAAAATGCCACTAGACGAGCTTTCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGA
GCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCT
CGTGTCGTTTCAGCACCGCAACGAGCCTTTCTTGTTGACGGGCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGC
TTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTA
CCTGAACCGTCCCCCGCGGCAATCTCATGCATCATTGCTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGAATGGGATGGAGTTCTCTT
CACTCGTACACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTG
CACCGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGCCGGTTCCTCAGTGCCCCTATTCGCGAACGCTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCG
GATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCG
CGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCTCCTTGTGGCAGGTC
ACCCCTTTTCACCCAAAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGA
GACCTCGTTACAGTGGGCACCCGGTTTCCAATCCGGCGTGCCCACACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTGAATTCTCGCCACT
CACGCCCTGGGACCGACAAATCTTTGGTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCACCAT
TACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCTGGAATCATGAAGTCCGTTCCCAGGACCACGTCCACTCCTGC