Description :
From Genome Similarity Track
Location :
contig_2:1067012- 1069004
Transcript NameFunction/comments
g675.t1hypothetical protein

Sequence
1992 bases(100 bases per row)
CTATCTCCGCGAGCTAAGAGGTCACGGTAATGTCCGTATCCCGCTGCAGTGCACTGTGGATTTTCAGGGATTTCGCGTCCTCTGCTCGTCAAAACTCCCG
ATTGAAGTCGTCGCGTGGACTGAATCTGGAGACATCCAACGCGTCTCGAAGCAGCTTGTTCACGGTAGCGACAACCGCGGTAAGACGGTGACTTTCCAGA
ACAAAGAGCTTGACGAGGCTTTGGCCAGTGTCGCCAGCCGACTGAACCTTAGTCGCCATAGTGCCAGGGGCTACGAGGATCTCACGTCCAAGAGTATCAA
CGCAGCAGCGGATATGCTTGGCTATCTCAACGGCCAGAAGCAGCTCGTCCTCGTCAATTTTGCACGAGCGATGCCCCCTGAAGACCCTGATGTTACGCCT
CACCTGCTGCAATCCACCAGAGGCATGACTATCCTGTGGCGTCAGCTACGGCCTGAGCTCGTAAAAAGCTTCAAAACGCCTCTTTCTCCTGACGCATTGT
CCTCGCTAACGTATCGGACTCCAGACTGGCAGACACAAGCGCTCGGAGTGGAAGAGGCGACGAAATATCTCGTCAAGCAAGTGGTCCCGCTGTTTGCCGT
CCAGTTGTCGCAGAAGCGCGAGTACTTCGACTCGCCCGAGTTTGACCTGGTGAAGGAGATGCATCGACACGGGATTAACGTGCGCCACCTTGGGCTTCTG
CGCTCCCAGTTTTTGTTTAAACTGTCTGGAACTGCCACGCTGCAGTACTCGACAGCGGAAATCCAGACCACGCAAGACTTCACCCGAGAATGGAGCGAGG
CGCCCACGTGTACATTAACGGGAGGGTTAGTACCGTCAGTCGAGACCGAAGCCACCGCTTTGACGCGACTTGCATCACGCTCACAACTACTCACACGGGA
GACTCCATCCAGAACGTGGCTGTGTATGGCGGTCGGTTAGACTGTCGAGAGCGGTCGGACACTTTGCGGCGCTTCTTGCTCGGAGAAATGGTAGCCAGAA
CCTTCAAAAACGTCGTTCGGCACCTCATGCGGCAAGCTGCGAAGGCCAATTCGACCGGTTTAACGCCCATGTTGCACAAGCACATACTGATCCAGTCGCT
GAACCTGCTGAGTGGGAGTCGAAGAGGAAGCGAAGCACTGTGGAAAACGCACATCTTCGAGGGAATTCGTGCCCGTTTCGGGCTACGAGCTGTGTCCGAA
GTCGACAAGCAAAACTTACGAAGACAGCTGCTTCCTGTCCTCGAGTACATTGTTCGGCGCGTAGTGGCTATGCTGGCGATCCCAATCACGCCGCTGTGTT
TGGAGCGTGTAGGCCAGCACCCAGACTGCTACACGTTCGTTCTGGACGATTTGGTCCCCTCTGGAGACCACTATCGCGTCAAACACAATGTAGCCATGTT
GTATTTCTCCATGGCGTCTCTGCTGCTACTCCAAGCCACAGTGAAGCAGGCCACATCCTACAAGCAATTGCTAGTAGCAGACGAACCGAGTGGATATTGG
CCACTGTGTGACCGCCGAGGATCGATCGAGCCAACAAATCTCGGAGCTTATGGTACCGAATTTCGAGGAAAATATCTTCCTGGATGCACTCTTGAAGGCG
AAGGCCCGATACTAAACGCCGACTTGAATCGATCCGTGGAGCTTCGGAAGGCGTCGCGCAGTTGCGTCCAGTTTCCTTACGACACTCGCTTTTATCCTTC
CGCCGTTGATTCACACGTGTCCTTGGAGGCTTGGTGTCGCTGCGATGGCCACGAAAGCTCACGGCGGGTGGTGCTGACACTGGGGCGCTTCTGTATTAGC
GCGTTGAAAGCAAACGTTTGGGCGTTCAGTATGAACGTCAAGAGTATCGACATCTTGGTGCTTGGGGCTCACGTGGTCATGGGGAAGTGGACGCACCTGG
TTGGGACGTACGATGGCACCATCCTGCGCTTGTACGTGGACGGCTTGCTCCAGAATGAAGTTGAGGTGGAGAGCGTGGCGGACTTGGAGATC