Description :
From Genome Similarity Track
Location :
Scaffold_164:1067- 7104
Transcript NameFunction/comments
g8622.t1hypothetical protein
g8623.t1ETP16360.1 sepiapterin reductase [Phytophthora parasitica CJ01A1
g8624.t1RAW31189.1 hypothetical protein PC110_g12451 [Phytophthora cactorum
g8625.t1ETP16360.1 sepiapterin reductase [Phytophthora parasitica CJ01A1

Sequence
6037 bases(100 bases per row)
CACCGCGCCGCATTTCTGATAGCAAGACATTAGTGATGTTTGAAGTCCAAACGCTGCTGGCGTGAAAGAGAACGATGGTGATGACTCGCCCATCGCAACT
GCTGCAGAAGTACGTTTCACGTCGTGCGATGCTAGCACTTGCGACAGCAAGACTGTAGCTGGACAACCTGCCAATTGTCCGGACAACCATTTTACGCATC
GAAGTACGCACCAGTTCAGTGGTACCGGTATCAGTCAAACATGTAGTCCGATTGAATCTACTCATCGCAAAACCCAGGTTTTGTTTATTGTTTAGGCGAC
AGACCTTTTTAGGTTTAGAGTTTGTTTCTTTTAGAGTTTGTTTCTTTTGTAGGCGAAGAGCAATGCTTCAAAGTACTTTTTTTACATTTAACATATTGGG
CCAAATTTGTGTTGACCCAAGACTGCAGCGCAAATGTAGACGAACTGACATCGCAGCAAGGCAAGCGCCCTGCTTAACCTCTAGCAAAAAACTCGGTTCT
GGGTCCGCTCCCAAGCGGCACCGCCACCATGCCATCGCACTTTGCTCCGCTCAGGAAACGACCGCTGCAGGGCCATCGTCCTGCCGCAGACTACGGCAGC
GAAGACAAGCGCGCTACGAAGAAACCGCGCACCTTCTTGTCGATGAACGGTGTTTGGCGCTCAACTATGGTCCCTGCATCTCGAGTTGCTTGCCCGCACC
CTCTCCTCTGTAAGGACGTCAGGAGCCCAACGGTAGGCATGACCCCCCAAGCCGCGGTAAACCTGCTCCTGTCCACTGCCGGCACTTTCAAAGGGCAACC
GCGATGGCCTCCTTCACGAGCGTGACATCGATGCAGTCGACGCGGCGACGACGGCGACATCTCGCCGTGCTGCGCGTGTCAAACCACCAGACAACGAGCT
GATCCTTATCAGGTTTCGCGAGTCGGTCCTGCAGAGACTGTATGCAGACGCTTTGCATCTCCGCTGCCACGATATCAGCTTTACGAGAGTGTCCAACTCC
GTCTCGGTGTTTGACACGCGCCCCGGTCCGATAAGCGCCAGCAGCAGATCCTCGTGTCTTGGTGCTCTTTTGGCGCGTGCTAGTCGTCGGCGTGCACCAC
CAGAAGCCTGTGATTGGTAGCGTGCCGCACGCCTGCCGGGCAATCGATGGGCAACAGGACAACCACAACGGCAGCAGAGACCAGCTGGCGCGGAGGACAC
CTCGGCAAGATCCTGGCCGGACCACCCGAACCGGCGTCGGCCAATCGCGGCCCGCCATTGTTGACAGACGCGTGTCTGCACCGTCGGAAGCGCCATACAA
AACCCAAGTCAATCCGCTCGAGCGTGTGCCGGCACGCGCCGATCGGACCAATCAGCGGCCGAGGCGCCACGCGCCCTGGAACTTCCGGCGGAACCTCGAA
GTCTCGAGCGCGTGCTGTCAGCGCTGGAGTGACCGCTTCCGGCCAGCGGCGAGGGTCATTCCCGTTGATGCGGCTCGCAATGCTTTCGTCTCCGTGACCA
CAACTGAATTGCCGCCGTCGAGCGCAGACTGATCCACCTCTACCACGATGAATAGCAAGTCGGACATCTCGTTCCTGCTGAACCCGCAGTCGAACGCCTG
CAGCTCTGCACTGCGCGTGCAGATGACTCCCCCCATGACTCCGCCGCCGACCGCGTTCGCACGTCTGGCCGCCATGGCGCAGAGTCCGGACGCCACGGCC
ACGTCGTCGCTGCTGCTGCTGGGCTCGTGCATCGCGCCGCTGGAGAAGATGAGCAGCTGCAGCAGCCACAGCCACAGCATTGTCACGAGGAAGACGCTGG
TGCCGGCGCTGTCGCTGGCTGCGCTGTGTGAGGCCAGCAGTGCGAGCAGCTACAGCAGTTGCAGTTGCAGCAGTGACGAGGAAGACGAAGCCGCAGCAGC
ATCAGCAGCCGCCACAACTGCGACACAAGCAGCAGCCACTGACGCAACGGTGCAGGCTTCGCAGACAACAGCGACGACGCCGGCCGCCAAGACCAAGACC
AAGTCCTCTAAGGCCAAGAGCAAGACCGTCCGCCGCACGCGCGTTCGTAAAAACCGCACGCCGCCCTGCCAGGTGGACGGGTGCACGAACATCGCCGTGT
CTCGCGGCTGCTGCGTGCGCCACGGCGGCGGCTCGCGCTGCACAGTGGAGGGCTGTCCGAACCGCGCCAAGCTGTACAAGCGGTGCTTCCAGCACGGCGG
CTTCAAGACGTGCGCGACGGAGGGCTGCACGAAGAAGGCGAAGCGCTACGGTCACTGCTGGTCGCACGGCGGCGGCCGCATCTGCGAGATCCCCGGGTGC
GAGAAGGTGTCGACGCAGGGCGGGCTGTGCTGGGCGCACGGCGGCGGCAACCGGTGCAAGCTGGAGGGCTGCAGTCGACGGTCGTACCAGAAGTACGGCT
ACTACTGCGTTGACCACGCGTCGCTGAGCAAGGACGAGTCGGCGTGAGGCTTTCGTACTGGTGACCGTGTGAGCGACTTCAACGTATGAAGCTGTCGACT
CTGGCAGCCGAGTCGAAGTTGGAGTAGTCGGTAGCATTTTCGCCTGCACGTTGTTGTAGGCGGGTACAGTAGTTTCTAGTCTGGTGATCACTATTTATCT
GGCGTCGAGCCGAGTGAGATGAATTCACATCCTATTTGTTTCCGTTTTCGAAGTTGTTGTCGGGTAGCTTGCTCTGGTTGTGGTATACGCCACTGCCACG
CTGACAGAGCGAGAGACACACATGTTGTCGTGTTTTGTGTCGACACAAGATAGGGGAACAAGGTGGCTGTGTATTCATCGATCGCAGACCCAACTGCGGG
TGGAGGAACAGGAGCTGGCCGGCTCAACACGACCCATCAAGGCAAGAAGACCAAGTTCATGTTGTCACCAGCTCACCCATCTTAGTAAGATTCTTACGTA
GTGTTACCTCTGCAGCTGATGACCGTATCATCTGCCAAGTCGGCATGCCACCAAACCAGACTCAGTGCTTGCTCGGAGGGTCCAGGTCGTAGTAGTCAAC
ATGGGCCCCAGTCTCGTACTCACCGCTAACAGCAAGGTTAATTCCGCGTTGAGAAGACTGGGCTGGCGGGATAAGAGTGCCTTGCGCCTTCATGTCCGCG
AATTGCTTCCGAAGCTCCGGGTCCACGCGGGACGATTCGCGGATGGTCTTCTGCATGCCTGTGTCCATCGGGCCAGGAGAGTACTGCAGCACTCGAACCT
TGTCAACTGCTGCCTGCTCCGTTGCGACTACGCGGTGGTGCATCTCGCGCGCCGCCTTGCCAGTGCAGTACATCATGTGCGTCTTGAACGGCTCAATGCC
ACACAGCGACGTGATGTTGACAATCACGAGCTGCGTGCTCTTCTCCTCACCGACCGAAGTCGACGTCAGCAGCTCCTCGCGCGAGGCTCCGTAGACATCG
AGGAAGCGCTTGTTGAGCCATAGTACTGACGTCACATTGAGCTCCCAGTACTGCGCCAGCTCCGTCGGCGAAGACGCGCACTCTTGGGCCAATCCTAGTT
GACCCTGCGACCCCGCGTTGTGTACGAGGAAGACTCGGCCGTAACTCTGCGCTGCCAATTGCAGCAGCACATGGTCCACTTTGTGCGTGTAGTCGGCAGC
GTCACTTAGGTCCACGCACTGCAGGAAGCAGCGCAGCTCCCCCGTCGCCGCTGCTTTTTGCCATTCTACGCGTGCCAATCGCTCGGTTTCCTGGAGATCC
TCCTCACTGCGAGCCCAGAGGTGGAGGTCCACGTTCTGTGTCTTCAACTCACGCACAAAGTCCAGCGTGAGGCAGCGGCCGAATCCCCGCGACGCACCCG
TCACCAGTACAGCCGAGGTGGTCATGTTCGAAGCGAATGGACTGAATATGGTTGGAGGGCTGCTACAAATCCGAGCGACAATGGTTTTGTCAACATGTTC
GATCATGAATCGTACGAAGTCAAAACAAAAGCGTAATCCAAAACTTTCAAAAGTTCCCCAAGCACTCGGTTTTCAATGCAATATGTACACGAGACTACGT
TCACACCTATCAACTGAGTGCTCAGTCCTTCTTCGGCTCCAGACGCTGCAGCAAGCTCGCAATGAGTTTGGTCTGTTCCTCGCGGTCTTTCTTTCGCTCT
TCTCGCTCGAACTCGAGTTCCAACTGCCTTCTCTTGGTGCGCTCAATCTCGATTTGAAGTTCGAGAGAGCGCTGCTTGGTCTTCTCGCCCTCCTCGCGGA
GTCTCGCTTCGTTCTGCTTCTCCAGCTCAATGATGCGGGCGTCACTCGGTCGCAGCGCGATGGCTTCCTGCATCTTGAACAGCTCCGCCATGGCTTGATG
CACCGTCACTAGATCTCCAACAACCGGTGTCTGTTCCTGCATCCGTGCAGGTTCCTTAGCCACCGGCGACGCGACCTCTGGGGCTCGATCCGACTCGGCT
GCGTCGTTCAGAATCTGCTCCATGCTTGGACGGTGCAGCGTCGCGACTTCCCGCCGCTCCGCCTCGGCCGCTGCATTGTCCGAACTCGCGCGACGTTTGC
CCAGTCGTGTGCGAGGCTCAGCGGTGGCTTCTACCGCGTCTTCCTCGCCCTCCTTCGCGCCCTTGACGCGGGCGTCGATCTCGGCCACCAGCTCGTTCAT
GACCTGGCGGTAGACACTATCGGGCTCCTCCGAGCCGGAGATGCTGGCCGCCTCCTTCCACACGCGGTGTCTGGCCACCAACGTATCAAACCGCGCCTTG
GCTGTCGTACCCTTGATGGGCCGCATGTGGAAATCCGCGTGTCCGTTGAGCTTCTCCGCCACGACGTCCCATGTACCGCCGATGGCCCCGTGCCGCGCCT
TGTACGGCGCATCCTCCTTCACCTGCATAACCAACAGTTGGTCTTCCTCGTGACCAAACCGCTGGCGCACGCGCGGCTCCGAGGGACTCGCGGGGTCTCC
ATCGACACTTCCTCGCGCCATTCTCAACCCGATTTTGAATCTTTCCAAAAACTATTCTGTACAGCCTATGCTATGTCATGTGTAACCTCCAATACGTCAT
TTTGAAATTGGACATGACCACCTCGGCTGTACTGGTGACGGGTGCGTCGCGGGGATTCGGCCGCTGCCTCACGCTGGACTTTGTGCGTGAGTTGAAGACA
CAGAACGTGGACCTCCACCTCTGGGCTCGCAGTGAGGAGGATCTCCAGGAAACCGAGCGATTGGCACGCGTAGAATGGCAAAAAGCAGCGGCGACGGGGG
AGCTGCGCTGCTTCCTGCAGTGCGTGGACCTAAGTGACGCTGCCGACTACACGCACAAAGTGGACCACGTGCTGCTGCAATTGGCAGCGCAGAGTTACGG
CCGAGTCTTCCTCGTACACAACGCGGGGTCGCAGGGTCAACTAGGATTGGCCCAAGAGTGCGCGTCTTCGCCGACGGAGCTGGCGCAGTACTGGGAGCTC
AATGTGACGTCAGTACTATGGCTCAACAAGCGCTTCCTCGATGTCTACGGAGCCTCGCGCGAGGAGCTGCTGACGTCGACTTCGGTCGGTGAGGAGAAGA
GCACGCAGCTCGTGATTGTCAACATCACGTCGCTGTGTGGCATTGAGCCGTTCAAGACGCACATGATGTACTGCACTGGCAAGGCGGCGCGCGAGATGCA
CCACCGCGTAGTCGCAACGGAGCAGGCAGCAGTTGACAAGGTTCGAGTGCTGCAGTACTCTCCTGGCCCGATGGACACAGGCATGCAGAAGACCATCCGC
GAATCGTCCCGCGTGGACCCGGAGCTTCGGAAGCAATTCGCGGACATGAAGGCGCAAGGCACTCTTATCCCGCCAGCCCAGTCTTCTCAACGCGGAATTA
ACCTTGCTGTTAGCGGTGAGTACGAGACTGGGGCCCATGTTGACTACTACGACCTGGACCCTCCGAGCAAGCACTGAGTCTGGTTTGGTGGCATGCCGAC
TTGGCAGATGATACGGTCATCAGCTGCAGAGGTAACACTACGTAAGAATCTTACTAAGATGGGTGAGCTGGTGACAACATGAACTTGGTCTTCTTGCCTT
GATGGGTCGTGTTGAGCCGGCCAGCTCCTGTTCCTCC