Description :
From Genome Similarity Track
Location :
Scaffold_727:1067- 4453
Sequence
3386 bases(100 bases per row)
GAGAAGAGAAAGAGAAGAGTGAAGATGGTCAAGGGATCAGCAACTCCGAGCGACGGAAGCCCAGCGACGGCTGGAGGATCGCCTCTTGTGGGGTCGGACC
CGGCGGATCAACGACTCATCGCCATGACGATGGAGGTGGGACGAACCGTCCAGTTCGACGAGGATGGCCAAGACCAGCAGAGCGAGAGCAGAGATGCAAG
TGAAGGAGAGTATGAAGAGAAGGCCGAGACCGCTGAGCTCGGAGAAACGAAGACTACCGCCGAGCTACTTGGCGAGGTGGAAGAGTTGACGCTGCAGGTG
GGACGCATGGGAGCCCCACGTCCTGTCGAGCGCAATTTATCCGCCGAGCTCGACGAAGGTGCGGACGATGAAGAAGATGAAGAAGACCATGGCGTTGCTC
AAGGGGACCGTCCGCCCCTTATTCCAAAAGCGACGAGGAACGCCGATACGCCGAGCGCCAATAAAGTGTTGGCTCGACTCGGCGAGGAGATGAGAACGAG
ATCGGAATGGATGATGATGTTCGCGCCTGTGGCGATGGCGCAGGCGAAGTGGCCGATGTTGGGTCCCGAGTTAACTCAGCCGGTGCGTGCAGCCAACATC
AATCAGTTGGTGGAAGAAACTGTGTTGCTGTTGAAGGCGATGGGCTATCGGTGCAACAGCCGACCAAACAGCCTCATTCTGTCCGACTGGAGTCTGACCC
GTGGCGGAGCCGAGCTCTGGCAATGGAAATCAGAAGCTGAGAGTGGCGTTTGGATTGGAGAAGGCCCCTGGTGGAACGAAGAAGGTGTACGGCCGAGTAG
CCGAGTTCAGACCGCTCGGCGAGGACCCGAGCAAGATTCCTTTGCCAAAGACCCCGGAGACGAAGAGACGGGAAGTGTTCCGCGCTACGCAAGGGACTCC
GTACTTCGAAGACTCCCACATGCTGACTCCACTGAAGCTAAACCCGACTCAGCGAGCGCCGAGTCGTGGGCAGCGGAATGTAGGTCGTTACCGTGAATTG
TATGACGCTGCAGATGAGGCTGAGGCTTACGAGGAGGATGAAGAAGACGACAACGCCTTCGACGTGAGAGGTAACCATGAAGAAACCGTGAAGGACTACA
TCCGAAACTTGAGCTTTGACGCGGCTGAAGAGGACTCGACGCAGTACCTAGAAGTCCGAACCCACGCCTCGCTCGACAAAATCGCCGAGTTCGAAGGAAA
GCGCTACCGCTCTGACACGTCGCTCCAGTGGCTCAAGCGTTTCATCTACGAGATGAAGAGCACCAGGATGCCCCAAAGTGCATGGTGCGAGCCTTTCTCG
CTATGCTTGGGACGTGCGGCGAAGAGTTGGTACAGACAGCTGCCGAAGAAGACTCAGCGACGTTGGAAACTACTCAGCGAGGCGTTCCTGGATTATTATT
GCTCACAGTTCGACCAATCCGCCCGCACTCGTTACTACTCGGCGAGACGTAAAGTCAACGAACCGATCTGCGACTTCCTGATCCGACTCAACGGGTATGC
TCGGACAGCCAAGATCCAGTACGAGAAGTGTGGCGCCGACGCAGCTGACCATGTCGAGCACTTCTTGATGCATTGTGGTGATGACGATGTGATGGATTTG
ATGTACCCCTTGCAGTTGGAAGACATCAGTAAGGTGGAACAGATAATCAATCGTCGGATCCTCGGCGAGAAGCGCAAGAAGCAACGCGACCGACTCGTGA
TCGCACGAGGCCGAGATGACAAGCGGAAGGATCAGAGCCGCCGAGATGAGAAGCGCAGTCGCAAGGAAGAAAACCGCGACCGCCGAGTCACTGTCGTTGA
CGCTGACTCCGACGGAGAGGAGCTCATCGATCAGAACCCGCCGAGTCCGTACAACTCCGAAGACGAATGGGATGATGAGGACCAGTCCGGAGGACACGAC
TCAGCGGAAGACGACGACTACATTGACGCCGGTGTTTCCAATGATAAAGGAAATACACCGGACCGCCGAGAGAACTCGACGGGAGACCAGAAAGGCTCGA
ACCGAAGCTGGGGAAACTCAGCGAACCGACCTCCGCGACCGTACAACCAACGAGAACAGTCGAATCGTGGAGATGGATCACGCGACAACACCCAACGTGG
ACCTTGTGCAGCTTGTGGAAGAATGGGGCACTCGGCTCACTACTGTCGACGACGCTGCAAATTCTGCAGACAAGTCCATGAAGGCGGCCAGAGCGAGCTG
TTTCGTCAATATGAGAAGCTGGCTGCGTTCGTGAAGAACTCTGTCGACAAGTCGCAAGTGCCAGAAGACCTGCAAAACCTTTACGCGCCGAGTGATTTAA
ACTCGGCGGCCCGCCAACACTGACTGGGTTGGAATATGCCGGGCTGCCACAGTCAGCTGAACCTGCCGTTAAGGTAAACTTCTTGTTTGCCTTCGTAGGC
GAAGCAGGACGGCCCGAGGGAAGAAGCGGGGATGGCAATTGGATGTGTGAAATCGACGGAATTGAACGTGAGCTCGGTGAGTTAGAGGATAACAACCGAG
CGATTGCAAGTGTAACTCGGCAGTCAGACCAGGCTGTGCATCGTACCAGAATCATGAAGCTGCTTCCGGGAGAACGGCTGGGATGGTGGTCAGCACAGAC
GTTCGATCGCCGAGTTAGAATGAGAGCCCTCGTATTGGGTGCAGTGAACGACCGAAGGACCAATATATTATTGGATACCGGAGCAAATGTCTCGGCGATT
AGTGAGTACTTCGCGAGGAAACTGCGTCTCAAGAGAGTGGCCAGCAGAGATAAGCGAATCGACATACAAGGAATAAGTAAAGACAGAATGGTGACAACGT
CAAGAGCAGTGGTGAAGGTGACACTCGGCTGGGAAGTGGCATACGAGTTTGAAGTATGGATAATGTCTCATCATGCCGGAGTCGATTTGATTCTGGGCAC
CGACTTCATGATCCCAGCTGGAATCCGTCTGGATCTGTACAACTCGGCGGTCAAGCTACCCGATGAGATGGTGATCCCACTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN