Description :
From Genome Similarity Track
Location :
Scaffold_3268:1067- 2461
Sequence
1394 bases(100 bases per row)
CTCGAGGCTGCGTCCCCGTCTGCAAACGTCCGTGAACCGACCTCTCCAGCATCTGCAACCGAGCAAGGATCTCTCGGTTCGACTGACGCAGCTGCGCACT
CTCCCCGGTGGCCCGGGCAGTCTGATCGAGAGCCTCATCCAACTCCTGCTGGGCATCCCAGTAGCTGTTCAGCAAGTCGTTCTCGCAATGGGCAGCCAGA
GCGCGAGTGCTATCGACGCGACGGCCCTCCTCCTGTTGTTGACGCTGCCGGAGATACCCGCTGGATTGTTGAGTACATCGTTGCCCACGAAGATCCACTT
CGCGCTCCCAAACGTCATCGTGGACTCGCCCACGATGTTCCGGCCGACCGTCGCTATCGGGTACGATGGCTCAGGTTTCCTCCCGACGAGGATACGTGGG
AGCCTCGTGCCAATCTCCTTCGGGACGTCCCGAATGTGGTCCAGGCGTATGAGTCCAGCCTCGCTGCGAACCACCTTGTGACGCATACCAGCTCGCACGA
GGAGAGCGACTCGAGCGATCACGCGAACGTGATCGAGACCGATGACTTGGTCGACCACGTGAACGGGACCGAGATCTGCGATTTGTGCGACCACGCGAAC
GTGATCGAGAACGACGACTTGAGCGGCCGCGCGAACGAGAGCGAGTCCGATGCCAAGAATCTTCACGTGCAGGGCGTCGGCGTGAGCCGGCGCGATTAGA
GGCGCGCACGCTCTCGGCCAACGAGCGACGATACTCTCGATCACCGTGTCTGTCACGAGCGGATACTCGGCGATGTGCTTCTCACTCCTCGACAGTCGGA
CGCGATCCAGTACAAGTGCCACACCTTCAGCGACCCTCACGTAGAAGATGCGGCGCATGTCCTCCCATGCGTTGGTGCAGACGCGCTCACGGAGCTCCGT
GTGCGAGTGCTCCTTGACGATCTCGTCGCGGTACACCAGCCAGCCGACGAAGCTCTCCCCTTCTTCCTGCGTCCGTGTCAACGCCGATGAAGGCACACCA
CGACTCTGCATGCGCCATATGCGATACCCTCGACGAGCTTCGGAGCGCAGTCCAGCGGAGAGCGCCGGAGATGATTCTCTACTGCGTGTTCCGAGCGTGT
TCGCGGAGAGCCGCGGCGTCTCGCGAGATATATCGTAGAGAGAGCACATGGCCCGGAGCTGGGTGCGTCACATCACGCGCGTGCCGCGTGCGACTGGCGT
TGCAAGCAATCTGCGGTCTTTCTTCGGTGTTCCGGTCCGCTGTTGATTCATCGTGCTGCTTGTCGTCTTCTCCGCAAGTCGAGTTATGTCGCTCCTGCGC
TTCGCAGGAGATGTCTCCGTCTCTGTTTCGCTCCGCCCGTTAGCCAAGTCCCCGTTCGCCATCCTCACGCAGATTAATTTGTTCTTCGCCCACT