Description :
From Genome Similarity Track
Location :
Scaffold_1732:1067- 2345
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1732-fgenesh-gene-0.0Calcineurin-like phosphoesterase

Sequence
1278 bases(100 bases per row)
TCCGAATGCCTCGACGCAAAACAGCATTCTCTAACTCACTAGTTCTACTGCCGAACATTCAGTCCGCAATGGTGATCCGGCCCTCGAGCTCCGGGTACGA
GAGCAGCCGCTTCCTTGTCAAGAAATCCCCGACGACGGTCGTGATCTGGTCGAACGTGCGAACGACCTCGCCTTTGAGCCACGACGTACACCCGTCCCCG
CCGTTCGCGATGAACTCGGTAGTCGCCACCAGCACCATCGAGTCGAGAGTGATCTCACTTCCGGTTTCATCTGTCATTGCGGTGATCACCACTGGCTGAC
GGCTAGCAGCGACCTCCAGCTTCAAACCCGATACATGCGGGTGCGCGCCAGAGAGTAGCGGATACTTGGACATGTGCTGAATGATCGCATCACGGAAATC
ACGAGCCTTGATGCGTACGAGCACGACATGAAGCGGGAATGGCATCTCCTGCTTCAGAATACCCACAGTCACACTCGTACGGGCCTCATACATCTTGTTC
CCGCGGATAAAACCACCGTTGATAAGTCCAAAATCGGCGTTCAACTCGGTGCGCAGTGCATCAGACACCAAGTTACCCATATTGCACTCTCCAGCTCGCA
ATGCCGCCGTTCGAGTCGACAAAGGCGTCGCAAGCAATGCCAAAACGCGACCATTGTCGCCGGCGTTCTCCTCGTTCTCCAGCAACTGCATGTACTTGTA
CACGATCTTCTGACACTCGGGTTGTGGCGGAATGTGCTGATTCGCGACCATGCTCCACTGCGTCGACACGGCAAGCGGTCGCTCTGGGTGCTTGGCCGAC
TTGGACAGGTGGAACTCGAGCTTGCCGAGCCAAAACGCATTCTGACCCGACTTGTGGATGAACGTGTTTCCCTCGTACAGCGTGAATGGTTCGTGGTCGT
GGCCACCGAGCATCACATCGATACCCTTGACTCGGCGCGCGAGCAGTCGGTCTTGTTCGATGGTCAGGTGTGTGAGCGCTACGATGAAGTCGGCGCCTCT
AGCCTGTAGTTCGTCCACACATCTCCGTGATGTCGCGAACACGTCAGCGAACTCGACGTCTTCACCCGGGTACGACAGCTGCGGCGTCTCCTGCGTGCAC
ACTCCGAAGATTCCGAGCTTGAGCCCGTCGCTCAGCTCGATGACCTCCGTGTCGATCACACCATCCATCATAGCGCCTGTTGCGCGCTCGAGGATGTTGG
AGCCCAGGTACTTGAACTTTGACTCCGTCATGCGCTTGCGCAACTCGGCCGCTCCAAAGTCGAACTCGTGGTTTCCCA