Description :
From Genome Similarity Track
Location :
scaffold_1:106694- 109385
Sequence
2691 bases(100 bases per row)
TGTAGATATTTATGAAAAAAAGTATAGAGGACGAGAACTTGCTCAATTTGCTTAAATTGTGCAGTGAACGATACACAATTGATTGATCTCATGTTGTTTA
TTATCCACGCTTGACAAAATAAGTTGATCGGATTATAGAAGATATAGAGAAGTCCTCTTATGTACTATAAATGTTTTGGGTACAGAAGACATTGGTCTTC
CCTTTACTCTACAGTTGTAGCAAGAAATATAAAAGGATATTGCTCGTGGTTACAATATTGCCTTTGATAGCCAACATGTGTAATCCTTACGATTGTTTAA
CCAAGTGCATGCAAAATAAAGTGGTGCTCAGGCGCTTTCCTGCAAAAATGAGTGACTTAAtctttttgattttaaacTTCAGACTTAATAAATATATTGA
CCACTTTATGGCATTCGGAATAGTGACATCTTTAACATCTCATTGAAAATGCGACATTGCTGTTTGTGTGTCTTCCTTTTTTTTCGACTATAAGTTCATG
TCGATTATGTGTGGCCTCAAGTTAGCAGTTTTATCAGAGGCGAGACGTATGCCGTCTGATATAAGTAGTCAGGTAAGTGATGTAATTATTTAATTCGCAG
TGGCCAGCAAGATCAATACGTGAAATGCCAAATGTGGCAAAGGGATGCAGCCGCAAATGGCGTTATCATAATCTGTACGTTCTAGCTCGCCAgaaccgat
cctgtggtgcagtggtttaCCACTCATTTCAGGACCGGGAGGTCCCGGGTTNNNNNNNNNNAAAGGAGGTCAAGGCGGAGAATCCAGACACGATCAAGTG
CGACGCAGCTAAGTTGGAACTCTTCCTAGGCAAGAGAGATGGCGGCGCTTGGTTGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN