Description :
From Genome Similarity Track
Location :
Scaffold_38:106681- 109260
Sequence
2579 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNACGTCGCAAGGCCCAGCCAGCGACGAAGATCCTTGACGGAGGAGGGGATAGGCCACTCCGAAATGGCCTTAATCTTTTTGGGATCAGCCCA
ACATCCGTTCACCCCCACTAAATCGCCCAAGACTGGGATTTCGTCAACGCCAAACATACATTGAGCAAGGTTGGCATAGTGTCCGTTGGCACTGAGGACT
TCAAGCACTTTGCGGAGGTGGCCGCGGTGAACGTCAAGATCGGATTGCGTGGAGGATGCGCAACTGTGAACATAAATGTCGTCGAAGTACGACGGTGCGA
AGTCGCGAAACGCGCGGAACTTCGCGGTAACCATACGATTGAACGTCACCGGGGCGTTGGATAGACCCTGTGGCATGACCAGCCACTCCCATAACATGCC
ACTCGGCGTAAAAACCGCCGTTTTTGGGACGTCGCATAGACGCATCAAGATCTGGTAAAGCCATTGCGAAGGTCGATGGTGGAGAAAATGGTAGATCGAC
CCATGCCGTCGATAATAACGTCTTTGCGAGAAATTGGCGTCTGAGTCGGAATCGTGGCTGCGTTCAGTTTGTTAAAGGCGTGTACAATACGCCATTTCCC
ACCGGGCTTCTTCACGCAGAAGGTCGGGCTGCTGTGAGGGGAAATGCTCTCGCGGACGTGACCCGCCGCCTTGCGGGTCGCAAAGAATGCGTCGATGGCA
TCGACTTGGTCGCGAGGAAGCGGCCATTGCCGCGTTACACAATACTTTGCGCCTGGCACGAGGTCAATCTCGTGTTGAATGCCCTTGTCAACCGGGAGGC
GACACGGTACCTCGTCGGGGAAGACGTCCTCAAATTCTTGGAGGAGGTCGAAATAGGGGTTGGATCGTAGGGAGTCCCA