Description :
From Genome Similarity Track
Location :
contig_46:106672- 108204
Transcript NameFunction/comments
g10047.t1hypothetical protein

Sequence
1532 bases(100 bases per row)
CTGCAAATCACCAGTATGACACTTACCTCTGAATGAGCTAACCGCTGGGGGGCTGTCATGACGTCGTTTTGGTTTTTCGTCACAGTTGCTTCCTCCCCGC
CTGGCGGTATTCGAGGAGATTCATGCATTAAGCGATTCTTCGGTCTCCTGAGTTTGACGAAGCAGCATTTCTCTCAGCCGTGTGTTTTCCCTCTGCAGAC
TTGCATTGTGTTGCTGCAAGTGCACAAGACTCGGTGTTATCGCTCTTCGATGCCAGCTTGCCTTTTCTGACAGTACGAACCTCTAAAGATTTAACCCGCT
TTGTTTCAAGCACACGAGTTGCGCTGGGGTCGCTTTCAAATACGGCCAATCGCTTCTTTAGGTCCTGAACCTGTTCCTGGAGAATGGGGATGTTGTTGTT
CTCCGTCTGAAGGTGCTTGTTTTCCTCCAGCAACGATTGACTAACGGCATCAAGCTGATGTTCTTACTCGTCGCTAGCGTTTCCTATCATTGTGAACGGA
CCCAACAGAAGGAGCAATAAGCAAACACGCTGGCCGACCGGAAGCACAGACACGTAAGTGCTTACCATCAATACTTCGATGTGCTTCAGCAGTTTTCGGA
TCGTTGTGTTGGGGTCTGACGGGTCTACACCAAGATGTGAAGTCGAAACACTGGGAGACAAGCTCAGTTTCTTTAAATCCCCCAAGATCGTGGATTCTGC
GAGGCATCAGCAGCAGCCTCCACCTCTCTCCCTGACAACGGGTTAGCACTGCGCATTTTATCGACAAAATTGGATGCTGTCGGAGAAGTATCGGTGTCAA
CGTCCTCGTCACTCGAAAGTTTGGCGTTAGCGTGGTTGGCGGCGGCCTCCACTTCCACTGTCGACATTTCACCAGCATCGTCGGCCATGTATTCCAACAA
AATCGGATGATTGTTGAGAAAGTCATCGCGGAACAGGCGGACATTACCTCGAGGCATGAGATTGCTCGCAAAAGGATCGGTTCCATTCGACTTGAAGCTC
GCTGCGGTAAGGCTTCCACGAGACCCGGCGCCAGCAGGAGCTGTATATGGCCGAGCTCCGATAAACCCGTTGTTTCCCTCTCGTGAGCTCTTGTGCACCG
AGGCAAAGAACTCTTCGGTCAAGTCTTTATCAAGTTGCGTGACCTTGTCCCCGTCTAACATCTTGAGGCGCGAAAGTACTCGCACTACCCGGAATTTGTA
GCCTTCAACATCTCTTGAGCAGGGATTGCCACCCAAGTCCAATGCGCGCAGCTACCATACAGAAACATTTAACACGCAATTTCGTTCAGTCTCGAATAGC
ACGCAGCAAACAATAAGGGGGTCATATTTGAAGCAAACCTTTGGCAGACCTCGACACGTATGCAAGGCGAATCAAGGTCAGCTATCTGGTTTCCGTAGAC
AGACACTGTATTGAGCTCGAGCAGCTTGCGCAGAGGGCTAATGTCCACGATCTGTGAAGCATTACCATAGGTTCAGCCGGGCGCCCAAGTAATCTACAAA
CTACCACCTCAGCGCACAAGCAACCTGGTTGT