Description :
From Genome Similarity Track
Location :
Scaffold_89:106656- 107883
Transcript NameFunction/comments
Hyaar_Emoy2808841chromodomain-helicase-DNA-binding protein, putative

Sequence
1227 bases(100 bases per row)
CAAATCGTTCATCGGATTCCAATCGCTGTCAAAAATAATTACTGTATCGGCTGCAATAAGATTAATGCCCACACCGCCAGCTTTCGTACTAAGCAAAAAT
ACAAAAGACTTTGAGTGTGGTCGGGAAAAACGGTCGATCGCGCTCTGACGCATGCTTCCACCAGTAGAACCGTCCAAACGTTCATACACAAAAGAGTTGG
CATCGCAATAGCGCTCGAGCAAGTCGAGCTGCTTCAGAAACTGGCTAAATATCAAAATCTTGTGCCCATCCCGCTTAAGCTTTGGAATCAATTTGGACAC
GAGCATCATTTTACCAGAACATTCAATCGTCTTTTCCATCACTTGGGCTGATGTTGGATTGCTGCCAAGTTCGTCCAGCTCCCTCTCTTCAACACCTTTG
ATAAGGAAAGGGTGGTTGCAGCACTTTCGCAGTTGCAGCTGAATGTTATTCAGCGTTGGCAAACCGTTCTTCGTACCACGATACAGGAAGCTTTTATTTT
TGTCGTAGATGGCTCTATAGTACTGCTTTTGCAGCGTCGTCAATTCGACAGAGATGATCGTCTCTTCCTTTGGCGGAATACTTTTTTCAACATCCTCCTT
CACTCGACGCAAAATGTACGGCGACAGCAGCTGCTGAAGTCGTACAACCTGCTCCTGCGAATGCAGCTTTCCAAAATTCTTGTTGAACTCGTCCAAACTT
GCAAACTTTACCGGTTCTAGATAATTCAGTAATACCCAGAGCTCTTGTGTGTTGTTCTGTAATGGTGTTCCCGTCAGCAACACCTTCCGATCCACGTGGA
GAACGCGCATCATCTTCAGTACCCGTGATCCAGCACCCTTCAGTCGATGTGCCTCATCAACCACAACTAATCGCCAGTGAATGTGCTCGAACTCTTCGAA
GTCAGCCAGAATGGTCTCAAACGTAGTCAGCAAGATGTGGAACTTGAAAATGGAATTCCCCAAACCTGGGTAATACCATTCTTGATCTCGAATGACCGCA
CGCATATCCTTTGCAGTAAACTTAGTAGTGCGGTCACCAATGTCGTGGTAAACGCAGACGTTGAGATCCGTCCAGCTCTCAATTTCACGACGCCAGTGCT
GAATCGTAGAAAGCGGTACAACAATTAGATACGGACCACGAATGGACTCTTCTGACTTCATGTGCTCAATCAGTGACACAATCTGGACCGTCTTTCCCAG
TCCCATCTCATCTGCCAATATGCAGGA