Description :
From Genome Similarity Track
Location :
Scaffold_30:106644- 107655
Transcript NameFunction/comments
Aphas_H257_10018Sulphatase-modifying factor protein
Aphas_H257_10019Hypothetical protein

Sequence
1011 bases(100 bases per row)
AGTTTGAACGGCGAATGAAGTGTGGTAGATTGGGCGGGTACTATCAAATAAATCTCTACACACCCCAAGAGGACAACATACGTACGTTGCAATCACTGCA
CGAGATTCGCCCTGGGAGCGCACATTCCGAACAGGTTCCCCAAAACCAGTTGGATGTTGTTGGTTTCGTTGTGTGCGATGGGGTTATGGAATGCGATGCC
GGGGGACGCTCAGTTCGATCCGTTGAATTGCCGATCAGTGGACGACGGATGAAGCGCTTGCTTTTGGAGCTCAAGAGCGGGGGCAACTTGTGGCGTACTG
GCACGGGTTGGCCCTGTGGCGTGGTCGGTCGCAAATGCCCTCCGTCGTCGTAATGGCGATGGATGCGGTCGGCATACGTGTCCATCGTGACCAAAAACTC
GGTCAAGTCCAGCGTGAACAAGGACGTGGCTTTGCCAAATGCCACCCACTCGGCTAAACTAACGCGATGATGAGGACTACAACGTTTGGGATGGTTTTAA
GTGTATGGTTTACTTGATGCGGGCATTGCGGTCGCAATCGGCACGACGGAGTTGGTCCCTGTGTGCCGCCACCCGAACACAATCGTCATGTTGGCATTAT
TCGCACAAGAAACGTCATAGTCGGGTACAGTACTTGGTTTCGTCGAGACTGGGCAGCTCTTTCGCGCCTGTGATGGCCAAACCAAGCAATCGCATTTCAT
TTGCGTCCTACAAACTATGAGAGTCCTTATCAATCTTCAAGAACTCGACTGCACGTACGATTTCACCTAAGGCCATTTACCCACTAGTATTTGAGTCACC
AAGCTCACATCGTTCAACTGCAACTACCAGCAGCATTACCTGAATGATCATGGTCCAGCAGGTCAAATAACTCGACCAGTTTTGCCTCGCGAACGTTGTC
GTCGTCAACGAGGAGCATGACCTCGCTCCGTTTTGGCGATGCCAGTTATAACGGTTACTTTAATGTTTCGGTTACATCGGTTACAAGTCAATTCAAATGT
AACATTCCCAC