Description :
From Genome Similarity Track
Location :
Scaffold_1148:10664- 12422
Transcript NameFunction/comments
Phypl_g12564arginine biosynthesis bifunctional protein argJ, putative

Sequence
1758 bases(100 bases per row)
TTATTGACAGTGCAGCGTCCTCGTATCCACTCGCAGGTAAATGAGTGGTTGCTCCAGCCGAGTGATGACGATAATGAACGCGTAATCTAAGAGCGGTAGT
CGGCGTTAATGGCTACGTACTCGTGCGTAAGGTCGATGCCCAGAACTTGAGTCTCCTCGGATCCGACACCCAggtcgatctccatctgTAATTGTCATCA
ACCCGAAGCAAAGTTAGTTCCCACCTCAACACTGCAACAGGCATCGAAATCGAGCACATACCTCGACAAACTTTCCGTGCGGCGGGTAGTTGTGCGAGCT
AGCGTCAAGGCCACCGCGGGTGGGCTCAATCAGCATCGCGTCGCGCATGTGTGCCACAAGCTTGGCCTCGATATCGTCGTTAAGCACCATCTCGCCGTTC
TCGAAGATAACGACGCCGCCCATACGCATCTTCATGCGGCGCTGGATGTTCACGTCCTTGTGGTGCAGGCCCATGTACTTGCCCACAGCCATGACCAGGC
GGCCCACGTTCGGGTCGTTGCCGGCCACCGCGCACTTGAGGAGAGGCGAGTTCACCACCGACTTCCCAACGCCCTTGGCCATCTCCTTGGACAAGGCGCC
GCTCACACGCACGCGCATGACGTGGTGCGCACCCTCACCGTTGCGCACAATGTCCTCGCTCAGTCCGAGGCacacgtcgtgcagcgccttcttgaactcg
tccagtTGCTTCATGTCGAACGGGATCTGGTCCGACGAAACGAGCGTCACCGTGTCGGACGTGCTCTGGTCCGTGTCCACGCTGAGCGAGTTGTACGTGT
CTCCCACCACGTCCGTTAGCAACTGACGCAGCACGTCACGCGGGATCGACAGGTCTGCATCAGACGTCAAAAGTCAGTTCACCAAGTACACCCTCCCCTC
AAACACCAGACAACTCAGCACTTTACCAGTAAGAATGTACGACAGCATCGTGGCCATGTTGGGCTCAATCATGCCCGCACCCTTGGCAATCCCGacgacg
cggccgccgcaCACGTCCATGGAGCGGATCTTCGGGTACAGGTCTGCCAACAACAACGGTCAGCTTAAGTTCACCAACGCCTCCAATCGACTCGTGGCAG
TGCAGCTCACCCGTCGTCATGATGCCCTCGGCCGCCGGCAGCACCGAGTCGGACTGCAGGTTGTTGACGAGCTTGGGGAGGTTCTCGACCATGGCGTCCA
CGGGGATGCGCCAGCCGATGACGCCCGTGGAGCAGGGCAGCACCTGGGAGCCCGCCTCCAGTCGCAGGTGCTTGGCCAGGTTGTCGCAgacctcctcggc
gtcggccacgccgccgccgctggcgcAGACGTTGGAGATCTTGTTGTTCACGAGGATGGCGCCGAGCTTGGGCTCGTGCAGGCGCTTGCGGCCCACGAGC
ACGGGGGCGCCCGGGAACGCGTTCTGcgtgaagacggcggcgaagaGCGGCGTGGGCTTGACGGGCTTGATGAGCGTCATGGTCATCTTGGCCGGCAGGT
GCGGGGCCTCGCGCGGCACGAAGTCGAGCTGggtggtggccacggagAAGCCCCAGGGCAGGCGGCTCTGGTGCGCCTGCAGGTAGTCCATGTACTCGTG
GCGCGACTCGAACACGAACGGGTGGCCGTGGGTGGACAGGCAgcgcgcctgcagcagcgagcgcgggcggccgagcgacgccaagcgcaGGATCGTCATG
GCGGACTCAGGGGACGCGACGCCGCTTCACTTGTGGACCAGTACACTCGGAAAACACT