Description :
From Genome Similarity Track
Location :
Scaffold_6:106638- 112934
Sequence
6296 bases(100 bases per row)
TGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAA
AGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGAC
TGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAAATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCTGGGTTG
GAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGA
GATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGAGCAAAGATGAGGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGG
GAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCAACCGTAATCCAGGGGCCAGGTCGATCAC
AATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTTGGCGACC
TGGATATGTGTCAGTGGGATCCCGCCGATACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGTATTCCTCGGAGAGGTGGAGCTCCCG
GCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAGATCGACGGGTCGAGATCCAAGCAATGGAGGTTG
GATCCATGACGGGGGGCGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGTTAGAGCCGAACAGCCGGATCCCGC
TGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCG
TTAGAGGACCGACTGACAGATCCAACTGTTGGTTTCCTTGATACCAGGGTACCTGATTCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGCGCCGCGGT
GTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGC
GGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGT
CAGAAAATCCGGGAGAGCCGACATCTGCTGATTGGTAAAGGAAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGA
AACCGATCGCTCAGAGGGTGCGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCACTTTCTC
AACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATAGATTACCGTCTGGTTAACGGTCTGACTCGA
TTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTGGGTAGT
TACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCATTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAG
ATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCAT
TTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACCTTCCAATCCCGGCGAAATCGTGGGATCAGTT
GTGCGAAAGCGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTA
GGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCT
TCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGAC
CACTCCAGCTGTCCGAATAAAACTCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAA
CAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAG
CTCAACACGCATTCGTGGAACTGAGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTTATAGTTTATGCCAGC
GACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGAACACTGAAGCCGAATGAACTGAGCTACG
GAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTATTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTAC
GCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGGTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAA
GGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAAC
GCCGGATCCAGATCCCGATCCCGACGGTACAGACAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTA
CAGTGCGATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTC
CTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCAAAAAGGCTGGGGATTTGTGGGGATTCAAATTTGGATCAGACAGGTGCGAGGTGAGATTGACTGC
AAGGCCCCGGCCCTAACACTGTTACGACAGAAAGTGATGATCCACTTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCA
GTGCAGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGCACCGACTAGA
CGAAGTGGTGGTAGTGGGATCCGGAAAAAGGACAGTCCAGGTGATGGCCGTCGCTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAAATTCTCGAGGAA
ACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAG
ACCTGAGTCGGGAAGATGCCAAATTCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGT
CAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAG
GGTATTAGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGA
CAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCC
CCAGTCGCTCAAAGGAAACACAAAATTGTTGATTTGGGTGGACCTGTTACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAAGGCAACTCAGGGAACAGGACCGTGAT