Description :
From Genome Similarity Track
Location :
contig_114:106619- 108077
Transcript NameFunction/comments
g13402.t1hypothetical protein

Sequence
1458 bases(100 bases per row)
TCTCATTTACCACCAAAGCTTCGTTGGTTCTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCT
CCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTT
CGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACT
GCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAAACGATGTTGCGAACGCTATCACCGAC
GGAGCCACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACGCGCGTGGAGTCATTG
AAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGCTCGACGTATCGTCGACC
CGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTA
CGAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACG
TGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGCGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAG
AGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTA
AACTGCACGTGAACGCCCCACGGCTGATGCCACACCGACGTGTAAGGCCGTCGGGAGGTCCCGAAGCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTA
CCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGC
CGTCGTGGATACTGGGTATCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGAC
ACGCTGCAATTGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGA
GAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACT