Description :
From Genome Similarity Track
Location :
Scaffold_12:10661- 26964
Transcript NameFunction/comments
Albla_Nc14016140conserved hypothetical protein
Albla_Nc14016150GF18527 putative
Albla_Nc14016160Rab1 family GTPase (PiYpt1) putative

Sequence
16303 bases(100 bases per row)
CTATTCAGCGGATGAGCGGCTAATTATCATCTTGGAAAACGATCGCAACGCCGCGCAGAATCCATTTCTCTCGACCCGAGTCAGTGGGTAACGTGGCCAG
GAAGATGTATGTGGGCCCACGGAATCGCGTCAGGTACACCGGGCACTCGTACAAACTCGGATCATGACGCAAATACCCGACCGAAGTCGGCTCCCATTGC
GGCTTTGTCTGAACCGCTTTCACGTATACGATCGGCATGGGCCAAAGCAGCTGCTTGGGGAAGCTATCGAGCAGCATTCCTCCGCATTCCGTGGCCGGTT
GTTCGCCCACAATCACTCGATCGATAATCTCATCGGATGTGCTCCACCTAGCTCCTTCTAGAATGAGTCCGTGGACAAAGACACCGTCATCCGGATGATA
GTTTGCTTGGGACACATCCTGGAACACTGTCACGTGAGTTTCCACGGTCATTTGATTGAGAGGAAGCAATCGTCGACGGCTGGTTACTTGCAAGCAAGCG
GTGGTGAATGCGGTTGGGTTGAATAAACCCGGAAGCCACATGGAGAAGGGAGTGTTAAAGTCGGATTTCCAGGCTTCCAGCTGAGCGTATCGCGCAATCA
TATCCTGGAACCAGCTTGAGAGCGATTTCTTGGATGGCCAGGCTTTCTTCTCCCACTTGCACAACGAGAAGGGATTTCGTCCGGGTACTTCATTCAGCCC
GATTGCGGTCGCGAGGTCTTCCATGGCTTGTGACATATTCAATTGGCCGTACAAACCTTTCTTCAGGTCGCGTAAGGAGGTCTTGATCTCCTCCAGCAAC
ACATTCATCTGACTGCATTCCTGGAGAAGAACGACCACGAATGGACCATGTTCTTGCGTCAGCAGAGGCGTCGCGGCTTCCACGACATCCAGCATGGAGA
AACACTCGGGACAACGGGCTTCAAAGTCGTCAATCGCCAGCGATAATGCCAACGTCTTATCACCATCTGCGTCTCCATCACTGACCCCACCGCGCACGGT
CACAATCGTATAGCACAATGTCTCACAAGTTGTGGTTAAATATCCGATCTCCGCGTTAAGATGAAGGCCAAAGAGCGGTGGGGCTTCCGGCACCATATCC
TTATCGATGTAGGTTGCGTACGCGTTAAAGTCAAAATCGACGGGATTCGGCGATACAAAGCCCGGTCCGAGCTCCATGCCGCTCATCAGGTGAGGATGAA
GAAGGACGTTGAGATACGTGTTGTTCGTCCGTCGATCCCACGAGTCTGTGATGTGGCCTCCGTACATGATTTCGCCAAAAATGTACCGCAAATCGTCCCA
TGGGACCGCTTCATTAGCGTCCAAATACGACTGCAGAATGTTGGCGCAGATGCTCAGATCGCCAGTGTTAAAGCTGTACGCTCGACTCCATCCTTGTTGT
CCGAATCGCCTTCGTCCAAGCACAATCGCATGGAACCAGCAGAGTGCGAATAAGCAAGCTTTATACTCGCGAGGCTTGGAGCACGAGTCGATTTTTTCTT
GGCTGAAATTGGACCAAGCGCGACGCAGATTCGATTGGATATCCGCTGGGGCTTCATTTGCGACTTTGATACAGCTCTGAAGAAGCGATTCCGGGATGTT
GAGCATATCGGGAAGCGGTGGTGGCTCCGCAGAAATGAAGCATCGAAAGTTGTCATGAGCGCCTTCCGTAGCGATTTCCTCAAGCTGGCGTTCGAGTGTG
GGCAGCCACGACTGCATCAGATGCACGTTCTGAAGTATGATCCATCCACCTTGACTCGAAAGCCTCGCGAGCGATTCTTGAGCGTATGCTTCCTGCCCTT
GACCCATGGAAATATTGATAAAGTTGTTGTATTCCACGCCAACTCTTTTAGTCCGACCGAGCGTTTCGACCCAAGAGGTGGGATCAACGCCTGGAAATAG
GACAAAGAAGATTGGGATCGCGAAATTGGTCTCTTGATAGGTGGCATCCATGTCGAAGGGAGCTTGGGTCACGTACGATTCTCCAAGTGTGTCGCTGATA
AACGCTCGTAATGCGTTGGTGACGCGATCAGGACGAATGCATCGAAGAAGGACGATGCGTTGGAATCCGGAAAGCGATGCAAAGTCGCCTGATATCGGGT
GTTTCTCGGCATCTTCAGCTGCAAACCATTTTCGCCACTCATCTGGATCGTTTTGTATCGCATCGCCAAGACCACTAAAGCATTTCAGGGTCTCCAGCGC
TTTGAGTTTGGACCAGAGGGCCGATGATAGCCACTCTGACGCCATGCCAGCATTCCCAGCATCCGGGTGCGCTTTACTGATCAAGAAATGCTCCACTTCT
GCCGGGAAAAGCACATTGTCTTTGATGAGAATGGTGAGACACAGCATCATCGCAACTGTCAATTTGTCACGCTCAAACAAACCCCGACGGACGTAGTTAT
ACACACAGCGCGTGATGCTTTGCATCAACGCATCACATCGATGTTTCATCTCGTCATCCGATAGGTCCAACGCATCTTCCTGGTCGTTGGTTTCAGCCTG
CGTTGCATCCTCATCTTCGACCTCGACAGCGATCGGAGCTCTTTGAATCGGAACACAGTAGATTCCTTGCAGAAACACTTGCTGGAACGATGCTAATGAA
TAGATGTAATACGAGTGGACTTTGCTGATGTCGTTCATCAAGAAGAAGAGCAAGGACCCGCGTGACGCGATACTTCGGTATTTCTCGCTCGTGATATTGA
CTGATTCTTGGGTCTTTTTAGCCGCTTCCATGCTTTTCTGGGTGAGCTGAGCCTTGTGTTTCGTATCGCTCAAGATGCTGATCAACGGCTGGTTGTTGGT
GATATCGTCATCCGCGCTAGCAAGGTAGAAGAGAATGTCATCCTCCAGCTTTTTCAACTCAATTTTGCCTTGGTTTTGCTGGTGGATCAAATTTTCACGC
TTGATAGCTAGATCGGCTCGCTCTTTGGATACGACAAGGTTCAGTAGCTGATCTTCCAAGCCCAAAGCAGTGACTGTGAAGTTGACAATTGTGCATTCGG
CTTGAATCTCGGGCGGATAATGCGGGTTCCCGAGCTTTGTGTGGAGATACAGATGGAAATTCTCGTTGTAAGGCACAGACGCATCGCCAATTTGGATCTC
AAGACGAGCTCCTCGACGACATGTCGATCGTTGGATCACGGGTGCCAAAATCGGGTCGATTTTCTCGCCAAGATTCTCGATCAGGAACGCTCCATCTGTG
CCGATTGCCACTTTGAGTCGATCGATCCACATTTTTTGACCGGCACGGACGATGATGAGGTTGTTTTTGGCTTCCATTTCGCGGATCCAAGCAATGGCTT
GGAGCTGTGGGTCAATGATAAGCGGACGTCGACCCATTGAAACTGTTGTCACAACAATTGCTCCATTTTCGGTGGAGACACGATCGGAAGGGAGCTTTTG
TGTGTTCCATTCCGCGATCTGGGCGTCATTGGTGAGGATTGCCAGAGGATTTGCTTCCTCAGACATGGCGATACTGGACCCATTCGCGGCCTCGCGAAGG
TACGGAACCCAATGCTTACTGATCAATTCATCTCGGAATGGTTTTGTAAAAGGCCCAATGTACGAGATGAAGGCACAAGCTAGAAGAACGTCGCCTACCA
AAAGATCCTTCTCCTTTTGCAATTGCAATACATTGACACCCCAACGAATATTTTCACTGGAGAGATCCTTTGTGAGCGTTCCAGCCAATTTCATCTTCCG
ATTGCCTTGTTCCACGGACGCAATAGCTTCTTCTTTTTCCTTCTCAGCCGCTGCAGCTTCTTCGAGCAACTTGTCCAATTTCGCTTGGAGTTCAGCGACC
AAAGTGGTGACTTCAACAAGACGTTTGTTGGCTGCCTCCAACTCCAAATTGGCAGCCGCTAGCGCTTGTCGTTTTGGCTCCACTGTGGTGAGTATGTCGT
AGTACATGACGATGTTGATGACCCAAGAGCACAGACCAGCTGCAGCTTTATTCTTGGTGAGAATGACTTCGGGATTGAAGTACTCCTTATCCAGAAACTC
TCGAACCTCTCTCCAATTGAGCACCGGCACTTTTCCGTCATCCACGACCGACTTGAAATTCACAAGATACTCGATGTACTCTGGGATGTTCCCGAGCAAT
TGTTTCTTCACCGTATCCCACTTGACGTCCTTCACTTTGCCGGTCTTTGTAACCTGAACATTTGGATGAACGCCCGCAAGGAGCACCATGGTAGCTGCAA
AGATCTCATCGACTCCGGTGGGTGGCTTGGACATGGTCTTACACTCGCCAAGATCCTTCTTATTCAGCGAGTTGAGAGCTTCCATGGCTTGCTGAACCGC
TGGTTCGGCCTTTGCGAGATCTTCCGACGTCGATCTCTGCTTCTCAATGACCTCAGCTTGGATCACTGCACATTTATCGGCTTCGTCGCTTGCTTTCTTG
GACTCTACTTCGACCCGGGCTTTCTCAAGATTCACAGTCTCTGCAATTTGAGAAGCAACCGACTTTTTGTCTTCTGCGGCTTCCAATTTGACTTTGAGCT
CCACCTCCAAGCGGGAGACGGTCTCGCCCGTTTCTTTCAGCTTTTGAAGCCCTTTTTCCAAACGATCGATCGCTGTTGTGTACTCTTCAAACTTTTGTTT
GAGAATCTTCTTGTACAGCTGCAAGAGCTCCAAATACGACTTTGGGGTCGTGTACACGTGACGACGTTCGACTTGGAAGAAGCGCTCGGCACACTGATTC
ACAGACTGGAACGAATACGGCATGAAATTCTCAATGCCTGCACAGGAATCCTCAGGCCCAAGCAGATCATTGATTTCGCGAAGTTTTTCTCTTCCAACCG
ATAAAAGAGCCTCATGCGGCCACGGCTGGAACCAATCGATCACCGTGCAATTCACAAGCGCTGGGAACTTTCGAGCTCGATTTCTAAAGTCATCACCCAC
AGGCGAAAAGCACAAGCAGAGATGCAGGCGCTGACGCAGTTGTGCCTGGAAGAAATTGATAATCTCTTTCCGGTCTTTGGTCTGAATCACCGGCGTGATT
GAGCCCACGATCGTGTCGTAGTCTTCCACAGCCAATAAGTCGGGAATCTCACCAGATGCGAGCAGGTCGTTCAGGTAGATGAGAAACTTTTCGTTCGTAA
TCTGAGAGTCTGTGAGCATGAACACAATCCCGGCGTCTTCCTCGTTGCGGGACAGCATCTCTGCAATCTGAAGATGCATCTTCTTGAGATCCTCTTTGAA
TTCATTCTCGCCATACTTGGAGCTGATGGTGACCTGGACGACAGCGTACCCGCAGATATACGACGCCAAACGTGCTAGAGATCGCTTCCCGCTACCACCG
ACGCCGACCAGCAAGGCATGACCTCCATCGTTCTTCAGAATCCGCACAATCCTGGCCACATGTCTGATGGCATCGTCGAATAAGTCCAGGTGCATGGCGG
AATTGTTCTCATTCGAGTTGTACTCTTTCAATTGATGCTGCAAATTGGTCTTGAGCACTTCTAGACTGGGTTCCATGACCTGGTCGTACTCAGAGTCTCC
GTCCTTGGTAAAGTGGCAAAACAGCAAAGGCCATGCATTCTTGGCTGCGAAATATCGACTTATGTTACAGCTCGGAAATGAGCGCTTGACCTGAAGCTGT
ACGAGATGAGAATATTTTTCAAGATCGGCTTTGCACACGAGCCGATCGCCGTAGGTTCGTTCACTTTCGTGCAGCCAAAGAAAGATGAATTTCTCAGTGG
TTTGGAAGCGTTGTTTGCTGGATGTGATGAGGCCTTGAAATACGTTTGATAAATGGCGAACGTTGAATTCGTAGTGGAAATTCGCTGCTGTTTTTCGAAA
AGTGCTGACGACATTTGTATGAAGCATCAATGCTGCTTTGATCAGCGCGTTCGTAAAGGTGGAATTGCTTAGCTCTTCATTGAATCCGGCTAAATGTCCG
CTCAAAAACGTCTCGTAGATGGTTACGAGACTCGGGGCTTCTGGCATTCCCATGGCAAACGTGCAAAAATGACGCTGGAGACGTGGATCGATGAGAAAGG
ATCCGGCTGTCGGGTTTATTGCAGCTGCAAATTGGACATTGAGAATGTTTTGCTGCTGTAATTTACTCCGATCGAACCAGTGCTTGTACTCCAAGACTTG
TCGAGACAAAGAGATGGCGCTTTGCGTGTTGTAGAGATCCACTTCAGGCAGGTTGAGGTCATCGATGAAGAAAATTAAACTCGCTTTGCCTGGTGGTCCC
AAATTCGAGCCTGTTTTTCGCTCTAACTGACTCATCATCGCCTGCTGGAGAATCGCTGACGTCGTGTAGAAATTAAAGTTGATACTTGCGTAGCGAAAGG
CGGTATTGGCGTCGTCTTTGCTGAGCTTTTTCAGCATCCCAACCACATTTTGCGTCTTTCCTGTCCCTGCTGGACCGCATATCATCACTGGGATTTGCTT
AATCAGAAGCTTTTCAAGCCAGAAGGCAATCGAGGCTGTCTCTGTGGTCGGCACTGTGATCTGATTTATCGGAGCGGGCGATTGATAGCTTTCGGTGTAA
AAGTATGGAGACTTTGCCCAGGAATTAAACTTTGCAGAGTCCACATCGAGCCAAAAATCAAAGACCGTATTGCTGGCCGATGTGACCAACTTGACGTCTT
TCCATTGTGTCTTCCACCATGTACTGAATTCAATCGCGTAGTCGGTTCCGTCATCGCTGAGCGTGAGAATGGACCCGAAAGCCCACACACAACAAAAGAC
AAAAGTGCTTTGCATCAAGTTGAAATCCTGGACAACTTGGGGCGTAAGCAAGCAGTCGAGCATGTTGAGAAGGTTGGTGATCAAAGTTGTTTCTTCTACT
GGCACTATGGGACGCAATTTCTTCTTGAAAAATCTCAGAGTTGGCTCAATGTATTGCTCAAAAAGTGCGGTCAGTTTCCCACCGATATCGGCGGAGAACA
AGAGGATACCTTTACGCACGACAGCGCTGTTGGCTGTTGGTGTCATCGCTGGAGCCTCACTATCGCGCCGTTGAAGCTGATTAGAGCTGGAATGACGCTG
GAGCCAGCTGTCAATCAAACATCGCCATTGATACCCTTCCAATGTCGAAATGTATAAGATCCCAGCTCGAGAAACAGTCGCTGGCGTCGCGTACATGAGA
TCCCGAATCTCAAAGATCATCCGCATGTGTGATTTGAGAGGGATTCGTTCATTGGAGGCCAGTGTCAGCATCCGATTGTCATCCATCACAGAGTTCATCG
ACTCGATCCAGTTAGCATCAAGGTCTCCGTCGAGAATAATCCATTTCGGGCTTTCGTCTTCTTCTCCGTTGTCTCTCCGACGTGATCCAAGATCGCGCAT
GATACGGGATAGCAAGCCATCTTTCCATTCCCGAGTCTTTAGCACGATGTACCCGTACAGTTCATTCGTGCTCACAGCTTTGGGGTTGAGATCTTGGACT
TCCATGGACGTTCCCATGAGCTCCCTAGCTTTCTTCAGCGTCTTCCACGTTTCCGTCTTCCCGCAAGCCGGTGGACCCATCACGAAGACACAGTGGCGAA
TGGCCAAGAGCTCTGCAAGTTGCACGACTTTCAACATGAATTCGGGTCGTGGGGAGTTCTGAATGGCTCTGGCGGCGTCCTGAACCATTGTTTCTAGCTC
CACGTCTCGCTTTCGTGGTGGATCGTTACGAACATCAATGTTTGGGTCTTGACGAGGGAATAAATCGCCCAATAATCCGAAAAAGATCACGCTATCTTCC
GTAACAATTTTCGGAATATTGAAATCACGCAAGGCTCGCATCAGAAGATCGATCTCGGGAATGTCTGGCTCAGCACGTTTGAATGCTCCAGCAACGACTA
GCACCGATTTGACAGCTCGGAGTCCCCAGTCGTAATGAAGTTGTTTGGAAAGGAGTTGCCCCAGTAGCGAGTATAGACCGTAAAATTTTGATGCCAAGAT
CTTTGCCTGGGTGAACCCCTCGGCCATCAACATATTCTCACAAATCAGCACGAGATCGGGGACCATGACCGTCATCGGGCGAAATAATGCTTTGAGGCCT
TCGGGTAGCTCTGATCGACCCAGATACCCAGGGTTCATAGTAATAAAAGCGCCGACTGTCGGATCTAAATTGATACGATCTCCTTCCAACAAGAAGACCT
CATCGTCTGCTTTACACGCGTCACAAACAGCTTTGAATTGCACGGAGCAAACAGATAGTACTTCTGGAACAAGTCGATTAAATTCATCAAAGCATCCCCA
GGATCCCGACGAAGCAAGGCCTTTGAATATATTTCCCAAACTCTTGTAATCCATTTCTGGTGAGCAATTAAACACGTAGCATACTTTGCCAAGCGCATTC
GCCAAATCTTTGGTTGTTTCGGTCTTTCCGGTTCCGGCGGGTCCAGCCGGTGCACATCCCATTTTCAAATTAAGCGCCTGAGTTGCTGTCACATAAATCC
GATCGGTTAGAGGCGTGATGACCAAACGAGGTCCATTCCCAAGGTACTCATAATCGTAGGGCATTCCAGCATCACATATGAGGATTTGGGCTCGTTCACC
ATTAGGTCCACTGAAAGCTTTGTCACGCTTGAGAAAGCTTCCCTGGGCTGGTGAGAAATAATGCTTCAACTGAGATTGCCACTGAAAGCTACTTGCGTCT
TCCACTCCACCACGGATCATATTGGCAACGATATCTCGACCGTGAGCATCCATGGTGATCAGCACCATCACACGCTGACGCTCAGCCGATGAGATGTTGG
ATTGTGACAGTCGAATCAGGTCTTCCAGCTGCGTCTCTTGCTTCTTATTGTACTGCATCATGGCATCTTTATCGTTGTCCATGCTCATTCGATGGAATGC
AAGCTCCACTTCTTGGACATAATGAATGCCTGCAGCAAGAAGGATAATCTGAGCTGCATCCATAATCTTCCCGGTGGAGTCTTTCTGATTGATCCAGTCC
ACACGTGACATTTCTGTATACGACTTTAACGATCGTGTGATCTGCTGCGCAAGTGTGCTCCGCATGGCGGATAAAATCACATCCAGGTAGATCTCCGCTT
CGCCTTCCAGCTTGAGTGGTTCTACAAAGTCGACAACTTCCTGGCCAACACCAGCCACAAATTGCGTAGCTACTGGACGTTGGTTGCTGTCCTTATCACG
ATCGTGTGTCAGCGTAAGTGTCTTGGTAGCAAGAAAGATCTTGGAACAATGAGGCATGATGCGTTCAGGATGAGCTCCATTGGATAGGATATCGAGCAAG
TCTGCTTCCGACATGAAGTAAAACCTGGGAAACTGACGTCGTCGACCATCGAGAAACTCTTTGAGTCGTGATTTGCATTGATCGAGTGCTTCCATGAGCT
TGCCTAGTTGGCGTAAAAGGTCTGGTTTCGTACTCGATTGCTTCACATTGCGTGTTTGCCAGGCTTCCCACAAGATGACCCGAACTTGAACGTCAATTTC
TTCAAAGTCAAGCGTGAGCTCGGGAAGCTGCTTCTTGACTTCCTCGGATTGAATAAAAAGCGGCTCCAGATAACTCCAGGAGCGCTGGATATCGCTCAAC
AGCACCACAACCTCGTTGATGGAGGAGAGCCCAATCTGAAGATCCGTCACTCGTGCTTCAAACTCGGATTGATAAGGCGAGGCGCTCATGGTCTGTACAT
CAATCTGGTGAGTCTCCAAGAGTTCAAAGTTCTCCTCCGAGATTTTGAGCAAAGGAACGAAAGCTTCCGAGTTATTCGCGGCTGGTTGTGTTGCTTCTTC
CCCAGCTTCACACTCGATGGTAGCTTTCTGGTTGTACGGAGTCATTTCCCAGTTGACTTGAGCCCAAATACCTTCCAGGTCGTTCAAACGAAGCTCCAAT
TCTTGTTCTTTTTCTGCTTCGTAGCAAATCTCGGTAATCTCTGACGTGAAGCGATAGAGATTCCGACTCAAAAGCACACCCAAACGCTGCGTCGGGTCCT
CCTTCGGCGTTGTAAACGTCCCTGTATGCGCCATAATGCGATTCCAGTGGCGAGTTTGCATATAACTCGCCAATAAAGACCGGATCAAAGGGTGAGTCTT
CTCGAAAGCCTGACATTCGAGCAGGATGGTTGTATACGCCTCGCACCACTGCACATCTTTTGGAGTCTTTTTAAGCTCTTTCAGCATGCTTTGATTCTCT
ATTTGAAGGTGATTCACATCGGCCTGCTGGAAAACCATCTCATTCGCTTGACCCACAAATATTCTCGCGCGTTTGACGATGGACCATACTTTGGCTAATG
CTTCGACATCCGAGCGCATTTTTTGCATCAAAGTGATGGAATCATCCATGATGTGAGCGAATCCAAACGTTTGACAGAGTTTGGTTTTCTCGTCGCACTC
TTTCATGTCATTTTCCCAGTCCGATATGTACTGCTGAATCCTCTCCAGAGCTTTGTCAGGCTCCAACTGTGACGACCAAAAGTCATTCTTTTTGAGTGTG
ACAGACTTTTGTACGATAGACTGATGATACATCGCCATCGTTTCTTCTGTTTTCTCACTGAAAATGCGCGTTGGCTCTTGTATGTTTTGCTCTGTGATGG
GAATTTGCTTCAGAACTTCGGTAAACTGCTTCTCAATGTGTTCGATTTCGCTCAATTCTTTGTCGACTGGAGCACCAATTCGTTTGAGATGAGTCATCCA
CTGCCGACTTTGATCCAGCAGCAATTGATTACTACCTTTCTCCGATTCTAGGCGCCTGAGCGTCTCCTTTGTTCGACGTAAAATATCAAGGCCGCTGGTC
TCATGCGATATTATTTCTTTACGTAGATCCACCAACACACGCCGATATTCTGTGCTTCGGCGACTCAAACCAGCCATGAACGTTCGGATGAGATCGGAAT
TATCAAAGTCTTTTTCAGTCATTATTGAAGGCATGAGCTCACCGGAACGCTTGCTCGCAGATGCATCCGAGCCAGATACAAACGTAGCCTGGAATGGAGA
GCCCCGGATGTGGCCGGCGTGACCATTATAAGTTCCCTTGAATTCTATTGAAATGTTCCATGTGCCTGCCTGAGGTGGAGTAAAGGTGACAATGTACGTT
CCATCGGCCTTGTCCTGAGTATTGGTGACCTCGAACGACTCGACATTCAGTGGAGAAGCTTGGTCTGTATCCGGTACGGGTGTCAGAGTGATCGAAAATT
CGTCCCCACCGCAATCCCGAGGCAAGTTATCTTTGTCCCGAGCTTGTATCACCAATATAGTGGGGTTACCGACAACCGAGAGCGTGTTGAGGGTGGAAAT
GATGCTTGGTCCAAATGCCACCGTCTTGGAGGCAATTGAGACAGAATGAAACTTGAATTTGGTGCAAACATTGGTGTAGGCGGCACCATTGAGTGAAACG
CGAACTTCTGATTGCAAAGAGCCGTATTTCTCAAAATTTGGTGCGGCGGCCTCGATTCTCGTCGAAGACACGACAGACCCAATGACATCTGCATAGCCTT
TAGCGACCGCAAAGCGGACGGTAGCGGTTGGAGAGTTGAATTTAAACCCGCTGATGATCACTTTAGTGTTTCCAGTGATCGGTCCAGAGCTTGGCTCAAT
AGAAGAAATCGCGTATGAAGGACCGATAATCTCACCAACCTGGAGGACATGGAGATCACTAAACCAGCGGTTTGCCCAGCCACCAAATACCAAGATTCGA
TTGTTCGTTGTGTCGAGGATGATCGAAGTATCTGCTCGAGGCTGTGGAGGATCTCCTTTCACCGGAGGTGAGGACCAAGTCATTGTTCCAGTGTTTAGAA
CCATAATTGAGTTCAGGAAAGAGCCTGGTATACTGCTGGATTCAGCGACATCGCCACTACTTCCTCCAAACATAAACACCTTCCACTGCGGCCCAGATAT
CACACTGATGCACGCGTGATTCCAGATTGGCATGGGTGTTTTTACTGTCGCTTGCTTCCATTTTCGGTCATTCAGGTCAAAAATATAGGTATCCTGGAAC
TGTTTGAGACTGTTCCATCCTCCGATCACGATGAGTTGTGATTCATTTATGACGCACGTCTGATGGCCGGAGCGTGGTTCGGGACGATCGCCATCCGTTG
AGATTTCTTCCCACCTCCACTGCTCTAAATCTAAAACATGGAGATCATTGAAATCTGTCCGACCGTACCCTGCACCTCCGTATCCACCAAAAATATACAT
TTTGTGCCCCAACAATGTGGCTGTGTGAGCCCCACGGCATTGGGGTAGACCTTCCCAAACACCTTGCGCATACTTTTGCTCCCAGGCTCGTGTGGTGGAG
TCAAAGACCCACACATCATTCATTCTTTTATCAGCCGCAAAACCACCAAATATCACCAGGTACCGATTTCGATACATCACTGCAGAATGTCGCCATCGTG
GAGGCGGACAATCTTCTGTTGCATTGCTGGAGGAGCTGATTCTCGTCCAGCTGAACGCTTCGCCACACACAATGAGCCGATCACAAACAAGGAAGACAGC
TTTTACGTACCATTACCCGTGATATCGAGCTTGTAGAGATCATTAGTAGGTCCTGGAATCGCCTTATGATCACAACCTCCAAACAAGTACGCGGTGGTCT
CCGAGTCGGCAGACTTTAGGGTCAATGAATGGCCGGACCGCTTTACTGGAATGTCTCCAGTTTGTTTTGGGGAATTCCATACAACTTCTGGCTCAAAGCC
GTACCCGATCGGCTAGCAACAAGACATGTTAGCACACATGGAAGCAATGGTATCAGCTAGACGTACCATGTCGAGTGAGCTTTGTTACGAGTGAGGTTAA
GAGCTCGCAGCCACTCGGTATTGCCACCAAGATATCTGCTTTCAATGCGTTGGCATCCAAAGAAGACTGAAAGGTTGCGAGGAAGAGTCACGAATGGATG
CAAAAACGCAAGAATCTCTTTGCAAAATCGTTGTATTCCCTATATATGGCGACTTTTCGATGACAAAACTATAAAATATCGCCTTTTAGAACTCGCAAGC
ACACCGCTTAAAAGCCTTCTCAATTGTTGAATTTGAAAAAAATGATGTCGCCATCTTGCACCTAACAAGCAATACGTGCAGCTTCTCTAGACATCGAGCT
CGGTGTGATCATACCTCGTACTTCTTGCCTTGTTGCTTGAGTTTCCCTGCTTTCTTCACAGCTTCTTCGGTGCCATCTACAGAAATAGTTGCGTGATAAC
GCAGTCCAAGAATTTCGGATTGGATTGTCTTACATTCTTTCAGATCGGCAAAAGCTTGAACTTCAGCCATGATGAATCCTTTCTCAAAGTCCGTATGGAT
CACACCAGCAGCTTGAGGTGCTAATCGCCCTTTTCGGATGGTCCAGCCGCGTACTTCGTCCTTACCAGCCGTGAAGAAATGGATCAATCCGAGCGCGTGG
TATCCCATTTTCAAAATACGATTTATAACAGATTTGTGTGTGGGATTCTCTTTTTGATACTCGGCAAGCTGTCCACTAGCATCCATATCGAGTAGTTCAA
GCTCAAATTCGCAGCTGAGAGGGATGATTTGTTCTCCTCCACCGCGTTCATTGACATATTCAGCGATTTTTGGAAGATACTTATTGGCTTTGCGAAGGTA
ATCTCTTTTGCTTACGTTCACGAGAAACACGACTGGTTTTGCAGTAAGCAATTGCATCGTGTTGAGTAGATTGATTTCAAGCGCGCTCCAATTGCCAAAC
GAAACATCTTTGCCTTCCTGAAGCCATTCTTGAATCTAACAACCTCAGCGTCAGAAGTAGTGACAGAAAATGACATCGGTCAGACAAACACGTAGAAAGG
CTTCCAATTCTGCTTTTTTCTCTTTGCCTCCAAGACCACGTTCCACGCCCTTGCGAAAGCCGTCGACATGTTTTACCACCCGCTCGATATCCTTGAGACG
TAATTCATCCTGAATGATCTGGATATCTCTAACCGGATCCACGTTTCCTGTCCAACACAATTGAGCGAATTCAAATCCAAGTCCAACATCTCATACCTTC
CACATGAGTGATTTCAGTTGAATCAAAAGCCCGGACCATGTGATAAATGGCATCGACAGCTTGAATGTGTGATAAAAAAGCGTTTCCAAGTCCAGCACCT
TCAGATGCTCCTCGGACTAGCCCGGCAATATCTGTGATTGTCATTACTGGAGGCACACTGCAGGCATTGTCAGCTGGGAAAAAGCTTGCAAGGATTAGAT
GCAACGTACACGCTTGTCGGTTGATATTTTTCTACGAGCCAGTGGAATCGCTGGTCAGGAACAGGTACCACCGCCTCATTCGGTTCAATTGTACAAAATG
GGAAATTTTCGGCCGGTATGTTTAACTTCGACATGCAGTTAAAGAATGTGCTTTTGCCAACATTTGGTACGCCAACAATTCCGATTTTTACATTGTTTCC
AGGGCGCCCCAAGTACGAGCGTGGAGCCTATGTCAATGGTATGGATTTCATAGTCAGCGTACTACCGAATATGAGATATGGAGCTATGCACAACTTCTTC
CTGCTTTTTTTTCGGCGGCATTTTCGATTGGATGCCACACTTCCTTAATCACACTTAATAACAGTTATCAACGTTATTGATGATGTTATTAGCAGCTACT
AAAATATCAAATAACATGCAAACGACGAGAATCCGACGTGCGCATTTGGAGCTCTTTGCCGAGCTTGTTTATGACTATAGATGACGCATTAGTGACACAA
AATGAATAAAATACAGAGACAATGCACGTACCAATTGATTTACGGTGCGCAATGATTGCAAGCGTGATAAATACCGCCAGCATTATCACCAAAAATATAG
CGGCGATCGTGAAAATGTACTTCGGAGCCGCTGGAAAACTTGACAGCGATGAACAAGAGCTGAAGTCTCTAATGTTGCATAAAGTCCCTGTGTAGCATGC
GATACAACGACAAGTGGCGATGCCATTGGAGCTGATACACTGTCCTTTTGTGCCGCATGCTGCCGATGAATTGCATAGGGTGCCTCCATTTTGAACAGAA
TAAGAACCACAAATGCTCTGTTGCGTGGTATCAAAGGCTTTGAAAAGGATCACATCGCAGGTTTTCCCGTCATCAGTGCATACAACACCTTCACGCGATG
GAGTTTTCCACGTGTCAGTGCTGGCAACGACGAGATTCTTGGAGGAACAAGTCGGAGGTATCCATCCGTCCGATATAGCTCGATTATTGCTTGGGTCGAT
TTTTGCGTCAGTAAGTGGGTACCAAGTGCAAATATTATCCGAAGACCAGCTACCCACTTCTTTGTTAGAGTTATGCGAGGCGAAAGACTTTTTCAAATTC
GCATAATCAACTGTGGGAACGTCACTGGGCACACCGGTGATCTCGCTCGATCCGCCCGTAAACATTGGAAACAAGGAGTCTGCACTCAATTTAGCCAGTC
CGAAGGAATACGCTAGACCTCCAGAAAATGTAGCTGAAAACCCTTGAGTCTGACTTGGAGCGTCGTACATGAATGGCACCATTCCCCAGTCCCGAGGCGT
CGATTTAGTCAGCTTGCAGCCATATTCACCGAAAGCAATGGTAATGGGAAGCCCTTTTGCCATATTGAGGAATCGCTCATACGATTCGGCATAACTAGAT
TGTGGACACCACCGATATTCATTGATCAAGTAGATATCAATACTCTTGAGCATTCCTCCGTTCACCATTTGGTCACCACAGAGTAAGCCTTGTATTTTCA
ACACGTGATATATGTCGGCATTATCGATTTTACCAGCATAACTACTATCGGCAGCCGCATATGCAAGTGGAATCAAGCGAATCTTCTTACCATTCACCCT
CATCCAGCTCTTTAGGTCAGCGACGTACTGCTTGACGCAGGCAGCAGCTGTGAGATCAGCTTGCATGATTTCATTCGCTACCAGAATGGCCAACGTGTTA
TCGTACGCAGCAAAATTCGCAATCACCTATGAACCAGCTTTAGCGGTCAATGATGCCTCACGACATGAACATTCGCATCGCACCTTTTTCCCGTATTGAA
GCAGCAACGCAGGGTAACAAGTTTTGCTAAAGTCATCGTTATTTGGCCCAAGTCTCTTGTCGATCGTGGAGTAGCGATACACGCCATAGTATGGATTGTT
ATCTGGAGAAGCAGCGACGATGACGTACACGCCCATAGCAGCCATATCGTTCATGAACTTCTCATACGACTGCTCTGGGTTGACATCATACAGTCGGATC
GCATTGAATTCGAGGCCTTGGAGTTTTGTCCGAATGACATCTTTGGAGTATTGCTCATAGTACGTGTCACTCACAGCATATTCGTATGTCAGCTACAAAA
TGTGTCAGTGCCCTCGATTTCGTGGATGGAGCGTCATACCCCTTTGATGAAGAAGCGTTCCTTCGTTTCGGAATTGAACAATTTATTCCCGCGTACGATG
ATC