Description :
From Genome Similarity Track
Location :
Scaffold_2947:1066- 2562
Transcript NameFunction/comments
Phyta_totarag14960hypothetical protein

Sequence
1496 bases(100 bases per row)
CGCATCGGCCGAAAGAGCTGGGTCACCAGCCTATTGAACGTTTCTGGTGCATTCGACAGCCCGTGGGGCATAACGAGCCATCCCACTGGGAGTGCTCACC
GCAGTGAGGGGATATCTGACTCGCGCATCAACAACTGGTAATAGCCGTCGACCATGTCGAGCGCGCTGAAGAGGGTGCAACCCGCCATGTTGTTTTGCAA
CACGTCCTTCCGAGGGATTGGCGTCGACGCCGGGATGGTGGCtgcgttcagcttgttgaaAGCATGTACCATGCGCCACTTCCCGTTGGGTTTTCGCGCA
CCATGCCAGCGGCATACTTGGCGGCAAAGAACGCGTCGATCACATCGACTTGCTCCTTCGGCAACGGTCATTAGCGAGTGGTGCAGTACTTGGTACCGGG
CGCCAGGTCAATCTCGTGGCGGACGCCCCNCAAGCTCGCCCGCCTTCAGCGAGTCGAGGAACTCGACGTacgacagctcttcgagctcgagcaggtCCGC
CACCGTTGGTAGAGGGGCCAACTCCACACCTTCCCGGGTTTTACCCGTAAGAACGTCCAAGACGACCGGTGAGGCCGCCTCGCCTGTAGGCTCTGCCGTA
AGACGTCCCACGTCGGTTGGTCCTCCATCACTGGCTGTTACAGCCTGAGCTCCGAGCGTTGTGAGAACCTCTGTTCGACCATCCTGCCTTGCGCGAGCGA
CAGCTCCTGCGCTTTCTCTTGCGTGAGCTGTCTCAGCTCGAACGACTTCTCCCACGCTCAAAGAAGCGTCAGGAGGTCTGAATCGTGCAGTCGTCGGTGT
CGGAGGCGCCAATCAACACCTCGGAGGTGTCAGCAAAGTGCCGCTTGCGACGCGACACTCCGTGCTCATGCACAAACCCGTCtcaggaagaggaggggAC
ATGACCCACCAGGACTCTGTCCGCGAGAGGTTTATGGCTAGCACCGATGGTGCGACTGTGCCAGTCGATCCACGGCTCGTGCTTGATAAACCGCGGCATG
CCGAGAATCAGGTCGTACCGATCATCCATGTCAAGGACAATGAACGGTTCGACNTTTCTAAAGCAGTTGTATACAATGCACTGTTCCTAGCTACACTGGC
CTTCGTTATACGACGCGCTTGAGTCAATCAGGACGGTCATGGGGTCCTCATACCCTTTGACGCTGGCAGTGGCGGCCACCGAGAGACACAGTAGTGTCGT
CTCTGGGTCTTTCTCCCTCGGGGAAGGAGGTGACAAGGCCACCATCTTCCGAGAGGAGAGAAACCATCAAGCAGGGCGTCCCGTGCCTACTGGGAGCCGT
CGTTTCCGGCCATGAAGACTGTCAACTTGATATCGTCAGAGAGGGGAGCTCGGCCATGGCGGCTTCCAGTTCTGGAGCTCCATGATGTAGTCTTGAAGCG
TACGTTTTCCTTGCTTGCAACGCAAGAAGAACGATCGGTGGCGATAGGCCACGTTGGCCAGTAGGAAGGTGGAGCGAAGCTCTTGTTCCATGAACG