Description :
From Genome Similarity Track
Location :
Scaffold_5:106590- 107886
Transcript NameFunction/comments
Physo_128539hypothetical protein

Sequence
1296 bases(100 bases per row)
GGATTGACTACAAGTGCTACCAAGTGTGACGGAGTCACACAGCACAATGCACAGAGGAAGTGCGTGCGGATATTACTATCCAGGTGAACAGCAGTTCACC
AGTTCCCGGCCTCAATGGGAACGGTTTGCTACAAACGAGTAGGTTATAAGACTGACTGTATTTTGGTAGAGGTTAACTTGGTCGTAATACAAACTACAAG
TTAACTATACAAAAGCCCACACAAACTCAAATGGTAGCTACTGGTACCATGTACCATGTACTCGGGAGAGTGACACCCGTCACTCTTCATGTAATGGGTA
CACTTGATTGTACCCCGTTACATCCTCCCCCACTTATCTGAGAATCACATCTGATTCTCCAATCAGCTTCGAGAGAATCCGAACACCCAAAGGTCGGATT
CTCGGGCGCTGCCGCCGCAAGGCTGGCGCGCCTCATCGTCACGCCCACAGTGACTTGTGCCCGCAGCGGGCACCCCGCGCAGAACCCCCCTGCCCTCGGC
GATGTTGGCCGCGAAGCCGACGCGTTTAGTGGCCGTATTCACAGCGCTAGCAGGCGCAGAGTGCCTCGGCACGGGATGCATCTGCCTCCAAACTTGCGGT
GTCCCTCGTAGACAACCAGCGGTTGTCGTCGCATGGCCCTCGGGCCCCGCTGGCACGTTCGTGCTGCAGTGCCTCCCGCGAGGGACAGCACCTTTCCGGT
CAGCGCGTAGCGTAACCATGGAGAGAGCTGTGCTGCTCATCTCCGGCCATGACAGCGGCCCGACAGGGCCCCGCTCGTCACAGCACGGTGTGCCGGTCGG
ACGAATACGTCGGCTCGACCCATGGGCTATGGTCAAGCGCTGACAACAGCCATGAAGCGTCATGCTTCAACGTCGTGTTTGCTTGAGCGACCATGGCTGC
TTCCAGCAACCCGCTCATCATACAGAGCAACGCGGCGGACTTGTCTAAAGCCCTGCAGCGCGTCACGGCCATCACGTCGCCGACGCTAAGGTGTCTTCCG
TCGACACCAGGGTACCGCAAGGGTACTTCATCGTGGTGTGGGGTGTATTGCCCTCCGTCACCGGCGATCGCATCCTGCGTCGCGGCGACCAACACCAGGT
CGGTGTGCGTGCAAGACCGCATGGCACACAGTCCATACAGGACCTCAAGGTGTACGAGGGCACCACCTCATACGCCAAAGGCACGTCGTGTATGGCACGT
ACCACGACTGCCATAAGTGCCTCGTGCACCTCAAGTGCCACGTGCACAAGTAGTGTCGCGTGCACTAGGGGTACCTCGCGTACACCAAGTGCCACG