Description :
From Genome Similarity Track
Location :
contig_19:10656- 11740
Transcript NameFunction/comments
g5366.t1hypothetical protein

Sequence
1084 bases(100 bases per row)
AGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGATCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGGCCGCTTCAGCAAGAT
GGTACATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATC
GTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACATTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGA
CCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGACCGACTGCTTGCCGATGGCGGA
GTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTA
GCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACGAGCAATGTATCAGCTGTGACGACTCGCGCACGTA
CTGCGCGCAGTCATGGCGACGACAACACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAA
GGAGCACGAACTGAACCAGGAGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCT
GTCGATCGACAGAAGCTGAATGCCGATAACACAGGCAGAGGAAACACAAATGAATTTAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTA
AACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACAT
ACCGTCCAGGATGCGTTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAATACGAGTCACCTACGTCTGGTGA