Description :
From Genome Similarity Track
Location :
scaffold_198:10655- 12608
Transcript NameFunction/comments
g5511.t1 myosin-like protein

Sequence
1953 bases(100 bases per row)
ACCTGCACGAGGCGCCGCTGTTGGATCTGCTGCGCCGTCGCTACCTCGACGACAAGATCTACACGTACACAGGCGACATCCTCATCTCCATCAACCCGTA
CAAGAACATCCCCATGCTTTACAACTTCCCGGAACTTGATTCCATTGGGAAACTGGACAATCCAGTGCCGCACGTGTACTCGACGGCTCATGGAGCTTAT
CATGCCATGATGAAGGACGGCAAATGCCAGTCGATCCTCGTGTCTGGGGAGAGTGGAGCTGGTAAGACGGAGGCGTCCAAGTACATTATGAGGGTACGTT
TAAAACTGTTGGATATTTTAGTTAATGATGCTAATGTGTTTATGTTTTACAGTATCTGGCCAATATTTCCGAGATCGGCAAGAAGGCACCAAAAGCTCCC
AAAGCGGAGAGCGGATCTTCAGTGGAACAATGTGTGCTGCAGAGTAATCCGCTTCTAGAAGCTTTCGGAAATGCCAAGACGATCCGCAATGACAACAGTA
GTCGATTCGGCAAGTTCATTAAGATCTTTTACCACGCAGACGGCACGATTTCCGGTGCTACGACGAGTCATTTCTTGCTGGAGAAAAGTCGTATCGTTGG
CAGTGCTGAAGCTGAACGCAATTACCATATCTTCTACCAGTTGTGTGCGGGGTTGCCCACGGAGGAGAAGAATGCGCTCAAGCTGAAGCCTGCGAGCGAT
TTCTACTTCCTCAACCAAGGCAACTGCATTCAGGTGCCAGAAATCAACGACAAGAAGGACTTCAAGGAGCTGGTTGAGGCCATGGGCACTGTGGGTATCC
CACCGGAGTTGCAGAATACCATCTTTCGCCTGGTTGCCTGTGTTCTACACTTGGGTAACGTGGAATTTACGGAGAATGCTAAGAATGAGTCCCAGATCGC
TCATCCCGAAGACGTGACGAACCTGGCGGAACTGATGATGGTCACACCCGATGAGCTCGAGTTTGCACTCACGAAGCGCACAATGTCGGCTGGTGCACGT
GGTTCTGTGGCAGAAATCGCACTGACTGCTGTCGAGTCCTTGAAGTCGCGAAATGGACTGGCAAAGGACATCTTCAGCAAGATTTTCGACTGGTTGGTAT
TCCAAATCAACAAGTCGACGTCTAACGTCGGCGGTAGCTCCGTTGTTGGCGCTGGTTCCAAGTTCATTGGTATTTTGGATATCTTCGGATTCGAAAGCCT
GCAAGTGAACTCCTTCGAGCAGCTGTGTATCAACTACACGAACGAGATGCTGCAGCAGCAATTCAACCAGCACGTGTTCGTGTACGAGCAAGAGGTGTAC
GTTGAAGAAGGCATTGATTTTTCTCGCCTGGAGTTCAAGGACAACGGACCGTGTTTAGATCTGATTGATAAGAAGCCTCTTGGTATCCTGCCTCTTCTGG
ATGAGCAAGGAATGCTCGGCCGACGGGCAAGTGACGAAAACTTTATCCAGAAGCTGCACCAAACGCACTTGCCAAAGGGAAAAGTTCCTGAGGGCACAAC
GATCTACTACTCAAAGCCTCGTTTTGCGACGGACGAGTTCGTGATTCACCATTACGCTGGCGAGGTCACTTACAACGTCAATGGCTTCCTGGAAAAGAAC
GATGACTCGCTACACAACGACTTGATCTCGCTCATGGACAGCTCAAAGTGCGACTTCCTCCGTAAGTTGTACCCAATCGCTCAAGCAGGTGCTGCGGCGG
GCGGTGCGAACCCGCGGAAGCCCATCCGAAAAATGGGCAATAAGATGACTGGTACTATGACTGTTGGCCGCAAGTTCCGCGACCAAATGGCGAATTTGAT
GGTGGAACTGAAAGCTACAACTCCTTCCTTCGTGCGTTGTGTGAAGCCCAACAACTTACGTTTCCCGCAGGGCTGGAACGCTGAATTGATTCTTAATCAA
CTGATCTATCTTGGAGTGATGGAGACTGTGCGTATCCGACGGTCGGGTTTCCC