Description :
From Genome Similarity Track
Location :
contig_19:10655- 11740
Transcript NameFunction/comments
g5106.t1hypothetical protein

Sequence
1085 bases(100 bases per row)
AGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGATCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTTGTTGGCCGCTTCAGCAAGA
TGGTACATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACAT
CGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACATTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAG
ACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGACCGACTGCTTGCCGATGGCGG
AGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGT
AGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACGAGCAATGTATCAGCTGTGACGACTCGCGCACGT
ACTGCGCGCAGTCATGGCGACGACAACACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACA
AGGAGCACGAACTGAACCAGGAGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTC
TGTCGATCGACAGAAGCTGAATGCCGATAACACAGGCAGAGGAAACACAAATGAATTTAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCT
AAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACA
TACCGTCCAGGATGCGTTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAATACGAGTCACCTACGTCTGGTGA