Description :
From Genome Similarity Track
Location :
Scaffold_95:10654- 16275
Transcript NameFunction/comments
g13454.t1XP_008906758.1 hypothetical protein PPTG_12474 [Phytophthora parasitica INRA-310
g13455.t1POM72040.1 Glycosyl hydrolase [Phytophthora palmivora var. palmivora
g13456.t1XP_002898139.1 DNA repair protein RAD51 [Phytophthora infestans T30-4

Sequence
5621 bases(100 bases per row)
GGCTACGGTTTGAACCCGAACCAAGGCCGTGGCGCACCAGAGATCGATGTGCTCGAAGGAGGTGGCTTGGCCATCTCTTCGTCGCTGCAGATTGCACCGG
GGATGCCGGACGACTTCCGTCTCTTCCCTGCTGATGCAAAAGGAGCTGATGCGACCAACCCGTACTGTGTGTACACGTACGATTGTTTGACGCCTGGCGC
GAACATGATGGACGTCCCGACGGCTTACTACAAGAAGGAGCGTGGCCACAAGTCGTGGTACCAGGGGCTCCGATACGGCGCCAACAACTACTGCCAGCAA
GATGCCACGCTCAAGCAGGACTACGACACGGTCGTTGCCGCCGTGAAGGCTGGAATCACCGAGAACACGTGCACGGTCGATACGTGTCCGGCCTCCGCAG
ATGTGAACGGCGACATGAGCGTCATGGGGGACTCCAAAACCGCTCACTGGGGCATCAACTCGAACGGCACGTGCTACCCGCTCATGAACTCGTACATGGG
CGCCTACCTGTGCGACCCAGACAACACCGACTCCAAGTGTACCAGTCCTCGCAACTCCACTACCCCCAAGTACAACTCGATGAGCGAGTTCAACTACCAG
ATGGACGCTATCTCGTCCAACTGGCCCATTCACTTGGGCGGCTTGCCCCAACTGGATGGCCTTCGTGGAGGTGTTGAAGGAGGAACTGGGTCGTACGTTG
GCACACAAGGATGAATTCGTGTCGGAGACGAGCGAGTCGGATTTCAAGTACATCGTGGACGGCTGGGAGGCGAAGATTGTTCGTTGCGGCGAGGGAGACC
AGAAGTGGGGACTGTTCTACGGCAAGAAGGCATAGTTTTAGGCTTTGATCCTGCTAGGATCGTAGATAGTTTCGCCCAGCAGGAAGCCTGAATAAAAGAG
TAGTTTCGATTGAAAACGCCGCCAAGCTCGAAGGTGACGCAGAAGACTCGATTCTGCAATCGAATCTTGTAATTCCGCAGCAGCCTCAACAGGTTCAATT
TATGGGTTCATTCGTGAGAAGCGTGGCAAACGACCCTCATTCGAGATTTTGCTTGCCGAATGAAGATGCCACGCCAGCCCAAGTCGAAGAACCCTAGCGC
TAAAACTAAAATGGCCTCTGTCGTCGCGCAGACGACGGCAGCAGAGCGCACGAAAATCGTCAGGAAGCTGATGGTTTTCGTGCGCTCCAAGAGGAAAATT
GACTTTGCTGCTGTCGGACGCTCCTGTCAGCCCGTACGCTCCGGCAAAACGGTGAAAAAAATTCACGACAAGTTCCTACGAGGTGAAGTATGGGACCAAG
TGGGTCCTAGGGTTATACCAGAGCACCAACCGCTACGCGTGAACCGCCAGCTGCACGATCTGTTGAAGACAAAACCTAGCCTCACCAAGCGGCAGCAAGC
AGAGCAGCTGGGCATCAAGGCGTCCACGTTTTCGGAAATTACGCGCAAGATCAAGAGGATTCCGCCATCTGAAATCGTGTTCTCCTACGGAAATGCCGAG
TTTGGAACCAGGTTTAAGCGAACGCTCGCGTTAGCGCAGGATACTATCAAAGGTATGGTGTATTCGCTTACAGAGTTAAGTATCGGTGGAATTCTGCTTT
CTAAAGCTGAGACCGGCAAGATCTCGCTGCTGCTGGATAGAGGGCAGTTGCTGGCGCCTTACGAGATGCCACTTGTGGAGAAATTGCTAGACGCCAGCAT
CGACATTTTCGTTCAAGAAAGGGACTACAAGGTTACTCATCAGAAAACGTTCATCGTCGACAACATCTGTGCGATCACGGGATCTGCAAATCCAACAAAG
AACGGTATGGAGTTATCATCAGAGAGTTTGACATATCATTCCCAGCCTGATCAGAGTGAGTATGGATTTGATTTGCTATCGTTAGCATGACTAATTTATT
CTTGTAATTTGTTTTCACAGTCGATCGCTGCCTTCTGCAGCACGAACAAGAAACAAGAGAAGCAATTAAGATTGACAAGGCCTGGCTTGCAGCGGAATAC
GCACGTGTTGTTCAGAGCAAAGCGGGTACCAAGCGTCAAAGCTTTACTTCTCTTCTCACGGATGGCACGGCCTGCACAGGCTGCAAACAGCTGTTTGAGC
CCCAAGTGAAGCCGAACGGCGCTCTGTACAAGACGTGCACCAAGTGTCGTAAGTCAATTAGCAAACGCCATGCAAAGAAGATGTCTTCGATTGACAAGAC
CACGTACTGCCGGTGCGGTGGGAGGCTTCCGTCGACTCTCCGAGACGACGGCAAGCCCTTCAGAACCTGCCAGGCTTGCCGGAAAAGATACCTCCACGAT
TGTGATCGACTGATCGCCCTACATAAATGCCGGAAGTGCGGCAAGTCACTTCCAACGCGCTACCGGTATACCCGCTGCGAGAAATGCTTAGCCAGGGCTC
GGGAGAGCAGTAAAGCGAGGTACGAGAAAGCCAAGGCCGAGAAGCGTTGTCACAGGTGCCATGGCAATCTGGCGAAAAAGGCCAGCGGTGAGGCGTACAC
CCTCTGCGAGCCGTGCAGGATCAAGATCAATGAAAGCATGAAATCGAGATACATTGCTGAAAAGGAGAAGGGTGAGATCGCCAAAATGCACCCTAGCTTC
GCGGCAGAATATACCATCGCTCTGTAAAAAAAAAAAATTGTGTTTTTTGGAGTTTTTTTTTGCGTTGCACAGTGAGCACTTACTATCTTGAGAAAAGTAA
AGTCGACCGCTTTCTGTCTCGCCGACATCGCCAACGGAGTCAACCGTATTTCGTTCCAAAACCCGTTCAAAAACGGGTAAACTGGGGCACAACAAGGCTG
CTTCAGAACAACGACAGCGTGCTCCCAATCCCAGAGACATCGACTGTGTTCCTTACTGGTCACTCGGCCGACAATGTCGGCTACCAGTGCGGAGGATGGT
CGCTCAGTCAACAGGGATACTCGGGCAACGGCATGTTCCCGAACGGCATCAGCGTGAAGGACGGTTTCCAGGCGATTGCCAACGAGACGGTGACGTACTT
TAACGGCCTGAACTACACGGGCACCTACAACGAGAGCGACCTGGCTCAGGCCAAGGAACTTGCGAGCAAGGCCGAGTACACCATCGCGGTTATCGGTGAG
CACTCGTACACGGAGAAGACCTACGGCGACATCAACGACCTCGACCTGCCCGCCGGTCAGATCGAGTACGTCAAGGAGCTTGCGTCGACTGGCACCAAGG
TGATTGTTGTTCTGGTTGGCGGTCGCCCGCGTCTGCTTGGTGAACTGCCCAGTACCGTCCACGCTGTTGTGAACGCCATGCTGCCGTGCGAGCTCGGTGG
CCAGGCCCTTGCTGAGATCGTTTACGGACGTGTGAACCCTAGCGGCCGCATGCCGATCACCTACCCGAAGGACGCCGGCAACATCCTCATGCCGTACAAC
CACCGCGTGAGTACGCAGTGCGCGTCGGGCGCCTACTGCGAGATGCAGTGGGAGTTTGGCCACGGCTTGAGCTACACGAACTTCACGTACTCGGATATGA
CCATCAGCCGGTCCAATGTGACGTCCATCACGGAGACAATCGACGTGTCGGTAGTTGTCACCAACTCGGGCTCTGTCGACGGCAAGGAGACGGTTATGCT
GTTCCTCACGCAGCCGTTCCGCACGATCTCGGTTCCGGAGGTGAAGCAGCTCAAGAAGTTCACCAAGGTGGACCTGAAGGCTGGTGACTCGACCACGGTC
AACTTCACGCTGTCCGCGGATGACTGGAGCGTGTACTACCCGCAGATCGGCAGCGGCCTGAAGAAGGTGGCGGAGGACGCCGACTACGTGATTGCCATCA
AGCCGGAGACGGATTGCGATGTGTACAACGAGACCGCCGTGGCAAACCCGCTGTGCGCTACCTTCACGCTGGAGACGGGCGAACACCCGTACGGATCCTT
CGAGTAAGTGGAAGTATTGCGAAGGTGTTGCTAGTGAACACACACAGTGATCGTATGAAATCCATGAAGTAATTGTACTTGATCTTCTTACCTATGAAGA
AATGGTAGTCGGGTTGTTGTCCACTGCAAACTACTACTTCCATCCACTGACAGCTTTGATTCCCATGTGCGCGTCGCTGGAGAAGGAATATGCTGCGCCT
GGTACGATTTACAACATCATATCGCCAACTGTGCAGTTTGTTCATATTAGTCCATTTCAAAGACCGACGAAACGCAGGAACATCTGAGGGTACACGCGTG
TATTATCGCTAGTTGAGCTCGTCCTGAATTCCTTGCTCTGTGATGGAGTAGATGGCCTCCGACTCGGGCAGGATGGGGGAGTCAACGACCTTCATCACGC
GGTTTTCACCACGACCCTTTTTCAGACGAAGTCTGCACGACCCGCGTATCATAAATGTTAGTTTTGAATTCCTCAGCAGATAGTGAGCGTGACATACCTA
GTGCATGACGCATGGGCCATGATGTTGCCACCGATAGGCTGGAGCGGGTCTTTGGCGAACATACCGGAGTCGGGGTTTGCAGTCATCTGCACACGAACAC
AAATTATGATTAATATCCTTTCCGTGTACCTAGACACCAAGTCCAAAATGTGAAGACTAACCTGGTTGGTGATGACGACCGCAACACCGAACTCGTCCGC
CATTCTGGTTAGCGCACGCAGGAACCTAGTATAAACGGATGAAGCAGTAAATACATCAGGACCAACCCTCATAACACATTCCGCCAGCAACATACTTAGC
CAGCTCCTGCTGCCGAGCTGCCAGTTCTCCTCGGCCGGAGTAATCTGTCCTGAACAGAGCCGTCGCACTATCAACGATTACAAGTGCGAATCGTGACTCC
GCCATCATCGCTGAGGCTTGCACCAACAACTGCATCTGATGCTCCGAGTTGTACGCGCGTGCAAAGGCAACATTGTCCAGCACACTGTCGCCATCCAGGC
CGTATCTCTCTGCAATCGCCTGCAGTCTCTGTGGACGGAAGGTGCCTTCGGTATCAATAAACAGCGCCTTGCCCTCGCCGCCACCGCGATCCACAGGCAG
TTGGCACGTCACACAGAGCTGATGACACAGCTGCGTCTTGCCCGTCCGGAATTCCCCGAACAATTCTGTTATGGACCCCGTCTCCACTCCCCCCTTCAGC
AGTTCATCCACAGCATTCGATCCTGTAGACAGCGTAATTAAATCTTTCCTGCTCTCCAGCACGTCTGCCGCCTACATAGATAAAATAATAACTTTAGTAA
AAAATAAAAATAAACTGGCATGGGCTCCGCCGCGTCGGCGTCGAGGTGAATAAATTCTCACCGTTGTAAATCCCACGTTGACCATGTCTCTGGCCGCTTT
CAGCATCTTTTCGGCCTTCACTTCGCTGATTCCTTTGATACCCACGAGCTGCTTTTTCGTAGCCATGGCCACGGCGTCCACCGTGTACATCCCCGCGTCC
TTGAGCTTGTTGACGTCCGTGGCATTGATACCCGCTTGTTCCAGGATGTTCACGAGGCGCGGGCCTTGCTGCAGTAAAAATAATTTAGAAATAAGAAATA
AATACGCAATCGACAAAAACTTGCACTTGGCGATACAAACTCCAGGTCGCATGTGCTCAAGCCCCGCAACGACAGAGACCAACGCACCATCTCGTGCTGC
TCCACACCCATGTCCTGCTCC