Description :
From Genome Similarity Track
Location :
Scaffold_278:10654- 12458
Sequence
1804 bases(100 bases per row)
CGCTACAACTACGTGTCTCAGGGCTTGGTGGGGAGAGTAGCCGATCGGCTTGCTGATATCATCCCTGCTATTGTTCAAAAACAGATTAACGCATTCCTTG
CAAAGCGATTAAGTCTTACGACATGTTCGTGACGCGATGGCGGATAGCTAAGACAAACAGAACGAACAAGCAGATGCTAAAAGCAGAAGCTGTATTGAAA
GTTATGAGGTCGGTGACCAAGTCTTACTAAACGCTAAGTACCTACCTACAAATGTAGTATCTGCTGTGTTTAAGACGAAGTTGCGTCCGCGCTACATAGG
ACGTTTCGCGGTCGTGGCCAAGAAGGGCCTTGCGTATACGCTTAACTTGCCGCAAAAAATTTCGTCCACCCTGTGTTTTACATTGGCCCCCTTAAGCCGT
ATCGGGATACGTCCTGGTTTGGTCCGGAGGCTCTTGCGCCGCGAAAGTTGGCTTTGCCACAGGTTGTTGCATCCAAATCAGGAGATCAAGCTGCGTCTCC
GTCCGTGTATGATTCGTTTCCAAAGACGACAGAAGAGCTTGAACCACATCAAGTGTACTCTGGGTCAGACCCAAAGTCTCACGAAGAGTGTTCAGTTCAC
GAACCAGTTCCGCGCGGTCTGCAGCCGACACACAGGGCGTCACTTGCGTTGATTGATGATCAAGGAAACCTCTTGTTCCATATTGAGAGGATACTGCAAC
GACGTCGTCGTCATGGCCAATACCATTATTAAATGAAGTGGTGAGGGTGCCCTGAGTTTTAGAACTCATAGAAGTACAAGATACTCCTTCAGCAGGATTG
CCCATATGCCGTGGAGTGTTTTTGAGCGCCATGGTCGGGGTCAGCTAGCGACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTGTCATCACGGTTGGTACCAGGTATCTTTCACGTAGGACCCCACGCTCTTCAAC
AGCTTCAGGTGTCGAAGCTGCCGATACAATGTTCCATGACACCAAAAGCTGACCCACAGTCTGTCGAAGTAGTTCCTCGATACTGAGTGGCGTGAACACA
TAGT