Description :
From Genome Similarity Track
Location :
Scaffold_159:106510- 110914
Transcript NameFunction/comments
Phyci_15874Hypothetical protein
Phyci_245706Hypothetical protein
Phyci_15875Hypothetical protein

Sequence
4404 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACCGcccttctcgtaccggatcttggcggtgcgggcgtatccgttgagtcgg
atgaggaaaccgcacattctctttgcgtgtagacgagtagtatcttggttcgcgctgactggtcgaactcagagcagtaatagccgaggaacgccccgct
gagtaggttccaacgttgttgagtcttcttaggcagctggcgataccagctcttagccgctcggccgagactcagcgacaatggctcgcatcacgagttt
tgaagttgtcgagtcaccattatctcgtagatgaagcgtttcaaccactgtaaggtcgcgtctgaacggtatagcttgccctcgaactcagcgatcttgt
cgagcgagaagtgggtgcgcacttccagatacctgggattagcttgttcttcgccgccataactgagtcggcggatttgtgccttcaccgactcgtcagg
atcacccctgtcgtcccacgggtcctcgccgagttccacttcatcgctggggccgtataggtggccatagtgaccacgattcggcttgccctttctcggg
gtcaacatgtgggagtcctcaaagtacggagttccgacagtcgaccggaacttctcggctttctcggtcatcttcgtctccggggtccggggcagagaga
ctttgcttggatcttcaccgaagtcggcgatccgcttagcaattgtctgcttggttcaggggcccgctgcaaactgaactcggcgcgcagccgacgcatc
cactgaggcagctcactcccagctcggcgaacatcccagcccgataagatcaaaccgtcgggcctgcacgtgcagcgaaatcccatcgccttcagcagca
gcgccgtgtcctcgacgagttggtccagactggtgttgttgattggctgagtcagctcgggccccagcacctgccgcttcgcttgcgccattgcgaccgg
cgcaaacatcatcatccactcactgtggattctcatctcctcgccgagtcggctgagcaccttgttggcactcggcgtgtcggcattccgggttgctctt
ggaataaggggcggacgttccccttgagcatccccttgatcatcatcttcatcgtcttcgaccgcacttgcgttcagctcggcggcgaggttgcgctcaa
cagggcgtggatttcccatccgacacacctggagcgacaacccatcacttcgctgagtaactcagatgtcgacttgatatgttcgtcgacttctttactc
tcctcatcctcatatcttttgcctccagcttcgccatcctcgaactcggcgctccggaccgcatccatcgtcatgggtgtggccagcgggcccgccgagt
ccgatctcccggtcggggatccagctcgcgctgggcttccccgactcggcgatggcgatccattggctatcctgctcacttgttctcacttgacttggtt
atttggtacctgcgacaacacgcacaccctgttcccggtcgcggcggctcaagttgtgttgtagcggaacgcacaaattattccttgcacacagacacaa
caatcgccgagctagtcggcgcttattgtcatgcgctaggttgtccccagcggtccggcccttccgggacagcggtggcggtcctcgccgagaccaggca
accaagccagtcgttcctccggaagtcagctgagctcactgactcccgttcctcaaatccgagccgtccgccaaaggatggacaacggcgcgcgagcgct
tttacgggccaccgagagcaaaggattctcggctaaaagtgtcacggcacccgggctatccNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNagtgagaattaccgtatccactctgtatttgcaacgacagaccgctctgattttgaaacactttcgtcgacctcggtat
tcggcgggaattgccgtgaccgctcccactctgagacaccaaaccgctctcactctgagacaccttgacagtaccgtagacgatctgaccctgagacgcc
cgaccgctctcattctgcaacgccttcactcgcccaggctgctgcaccggaattcggtgccgggtcacatgccggtcaccgaattttggtgtggcactac
acaacagttgtacgtcattgaacctccggcccatacgccggacgaggtcgcgttgcagacctcactccgcgaccggcttcttgctctccaggccattacc
gtggcggagtatcgcgagcgtctgtaacgccaagtcttgcgccagtccgtgccgcagatgcggacgcaccccgtagtgttcaacccgagcgaggacccca
cggcgtatgaggcttaggtcgagctctgggctgagggcggccatcatctaccgtctatggaagctcttcgagcaaaattcagtgaaatggatgatcgtgt
tgaacgccgactccgcttcgagtacgcgaagctccgcgctaagcgcaaccagctccgctggcatcccgtcacattcccggataggttcggtgcaccacgc
tcctttgagtactccagcttctcctcatcgcgaggggaaaggaactgtggctcggggtcagtcccggatcaatgtagctgacccagcggcttcccaatct
actgctgggaagcgcggctcggctggcatgccggccgtgagccctcagagcactggtgatcaagctgatcaaaagcgccaacgatgtctgggcagtcagg
gtggaggggtacctcaaactcccacgaatttgctgagtgcgggtaccctcgccactttaccagatactggttttgaccccggcaccgccgcttcccccgg
aggggctctgcatgatagtggaggtttccctgctcatcgagcagcgccggtggtgggcgcgttatccccgaatcggcgatcggtgaacgagggagaggct
cgtaggcttcaccttcgccacgaggatctccgtgagcgcatcgactacattggccggcgtctaagtcgatgctttgacgatgtcgcggcgccggagcagc
gaatggattggatccaggttccggactaaatatataatcgtttccgttgtcttgagcaggttgaacgtgacaacgggtactgggtccagttacttcgctc
ccgcgagcatctgcaagctgggcgggttgcagcgctggagcaccgggctgtcgaacttcgtggccaggttctccttcttgcccgaatgcagggcgagcct
tcgcgcgactcccgtgcctgtggcactcccatcaacgacacttctgcccatgcgttcgacctcgtcgaccttgacgcctgcgacagggtcctcgatctca
tcgaccgcaatgcccgcggcgcctctatccgaggctgtaccggatcatgaaacggcttgagcaaacccacgtaaaagtgtggtgtagcgggatccgccaa
aatctggttaaggatagatcgagcttcccattaatgtccagacaccgactaacggagggggtcccccaacgatccgtgatcggctgaacttggtctcacc
ttgtgtacccgtcggcgggcaggatctgctctctctctctctctcgaggctccgaaaatgcagcacttgatgaagattgaatgtcttggcgtgacgcggg
gaaa