Description :
From Genome Similarity Track
Location :
Scaffold_1172:10650- 12218
Transcript NameFunction/comments
Phyta_totarag12284hypothetical protein PHYSODRAFT_262200

Sequence
1568 bases(100 bases per row)
gtNtcgtccgcctaaatgtagccattggtgtgccacatcaaggaaggaggtaactaacttctaacagaagccacttctgttaggttacaagtgatgtagc
cacttgtacgtgtaaccccgttacaccatCCCCCCGTTAAGCCAAAGACGTATCGGTCTTGACACGTCCATAACTGTATGGACCTTCTCGTCAATACTTC
GGAAAGATTCGAACTCATTTCGCAATGAGCTCGCCAGTCAACACGCCAGCGTCTACGACGCCTAGCGCCACGACAGAGGGTAACCTCTCTGTCGCTGAAT
ATCGTGCTCTACTTAAGCAGTAGCGTGGAGATGGCTCTGGGACAGACAAGTCTAAGTATGTTCCTGCTAAACCCTCAACAGTCTCCGGTGACGAAGACTC
TGACTTTCCTCTGGACTATGAGTCGCGttcagaggaagagggagCGTTGATGGAAGATGAGAAgttctcgtcttcgtcctcagccGTCGTTGCACGCGAC
CTTCACGCTGGGTCGCGTCGCCCGCGTGAAAAGACTCGAGCGCTTTAAGTCCAAAGCGCTCGCGAAGTGACGGAACGTCAGCGCTCACTGNGTGCCGCCC
AACCGGTGGCCGTTGTATGCGGCCAACAGCATTAATGATGATGCCGTGGCTAAGACTCAGTCTTTGATCCTGAAATGAATCAAAGGCGCGACTATTATAT
CGGACTCTTTCATGATCTCCGACACAATCGAGTAAGATGACTTCTAGCAAGAGTAAAGTGCCTGGGTAGCAGGCACTTTGCCAAAGTTGGAGTGCCTGTG
TtgaaaacttcaacaaagacCCTGCTGGATACCGTGCTCAGATTAtcgcagcacgtgaacgtTTCGCgaagttctcgaagcgtGGCAGGCTAAATAGCTT
GCATGGCGAGGCACTTGAGGCGGGGATTCCCTGTGCAGTGCTCGCCGGAATGCCGTGTGTTCACTGCCACACCAGGGCAACGACAGAGATGTCAACTACA
CGACTGTGCGTTTACCGGATATTCTTAGTATGCTCCGTGCTAGTGTGCAAGTACATTATGCTCCGAACGTTGTTGGCAACTACAAAATTCGTGCAAGCTT
TACACCTGCAGTCCAGGGTGGGCTTCATACGCCTTCACCATTTCTGGAATGCACTCCATCAGTACGTTTCGCGGCTCCCATGTATTTCGATGGAGAGGGA
ATTCTCTCCAACGAATACGAATACGAGCCTGTCTCATCGACTTGTTGTGACCAACGATCCGCGTCACAATCCAGCTGGTCGAGCCACGTACGTCACGccg
tgggggggggggcacgCCCTCGTATGATCAACCTCCGGTTAAGCCAGGTTCGAGCCGTCTCCTCGACCCATGTCGGCCGTGGGGATGCTTCAGAGCGCTG
AGTTCGCCGCTCTGACGCAGAAACTAAGCGTCGTGAAGGCtcagctcgtgctggtatCGCAGACcgcctcgaacttgagcgGCGAGCTTGGGACGAAGGT
CgtgaagttgacgaagcaGGGCGCCcctgcttcctcctcgacTTCGGCGAGTCACCAGCACATAGTTG