Description :
From Genome Similarity Track
Location :
scaffold_278:1065- 8961
Transcript NameFunction/comments
g6713.t1 hypothetical protein PHYSODRAFT_256669
g6714.t1 2-oxoglutarate dehydrogenase E1 component, putative

Sequence
7896 bases(100 bases per row)
TCGGCAGCTTACTCCGCTGAATTGATGTGTCACATTCATTGCAAACCGACATCCACGAACGCAGCGAAGAATCATCACCAGTGTAGCTCTGTATTCCACG
AGGTGATACTGAAGCACCCGCTAGCATAGTCAAATGACTCGGGGGTCGATACATATCCACGAGCTCCTGTGGAATGCCCGTCGTGTCAACTGAAAGCTGA
TTTTTCATCTTCTGCAGGTAGCTTGAATACGTGTCCTCCACCCGTCGTGTGTGCTGGCGAAGCACAAGCCGGTCACATGAGACGCACACGCATTCATCGA
GGCCTTCTGCTCCCAGCTCTTTGCGAAGCCGCTCCAAACATGCAGCCCGTTCATCGGCACTGAGTTCGTTGTCAAATGTGTCACGATGTTGTGTGTCCTT
GCCTGCTTGTCGTCCTCGCGTCACGTATCGCAGCTGCCGGTTGCGATGCAGCGCTATCTCCCTCTCATTGATGGGCTGACGTCGAATGTCTGCAACGCCT
TCGTGATGCCGCACCATCATGGCCGCTTGCTGCTTTCGCTTCCGGAACCGACGCACCCTGTTGCGATTGAGCTCTTTCTTCCTCTCGACATCCAAGAGGG
CTAGAAGGTCACCGTCATCCTCACTTGTCACTGCAGTGCTCGAGGCCACCATCGCGTCGGCTGCCGTCGGATTCGAGGTCTCTCGTGCTGCCCTAGCGCG
CTGAAGGCCCGTCCAGCATTCTCGCCACGAAGCCGCAAAAATATGAGCTGCTGTCGGGTCATCGTTCGCAGCGGTGCTGCGGCCTCCCTGTATGTCCGAG
ATGCCGCCTGAATTCACGCCATCGCCCTCAACCGCGTCCCCTGCATCCCCTGAGCGCTCTCGCACAGCAAGGCATCGCTTCTGGTTCCACTGCTGGTGCT
CACACAGCCGTGCATCGTCCAAGCGCCGGAGATCAGAATCGTCATCCTCAGTACTCAAGTGAGCATCCCAGAGCTTCCTCTTCCCGCTGGGCATCTGTCA
AGCACGCAGCAAATTCGCGAATGGCAGCTAGGTTAGCCCACGCAAGGCACGTGGTGTCGCGTTAATAAAACAACGGGACGCACCTATCATCAGTGCGTCT
CGAGGGAGGCTCCGTGCCCGATTAGCTCCTCTGTCTTGCTTTGCCTTGGTATTGACTCCCGCTTAGCCAGCATACCCGTTGTTTGCCTGTGGCAAGGCCT
ACAAGCCGGCCCGAGAGGTAACCTTCTCAAGGAGCTGATGCTTGACACACTTCCAGCACCCTCTGCATCCCGAGATTCTATTATTTTCTAATTTTTCCTT
AATTTTCCAAATTTCCCCTCTGGTATACCGGCCAATTACCCCCACGCCCATACAAACGTTGTGTACGCGTTGTGTACAAAATACCGGTTTTTGTAGCCAT
CATTAGCGTCATTCGAAAGCCGCTGTACTATACACAGTCCTTACGAACTGTGAATTTTGAGTTATTCAAGTTAACGAAGAGACAGATAAGCACTAATGAA
TGCCTAAATAGGGAGTACGGACCACAAATCCCAGGATATTAACGCGATCAGCGGATCCGCATACCAGTAACGTTGTCTTGTCGAATTTTCGGCTTGAGTC
AACGACAACTCAGGAGTCCTGATTACCTTTGTGCAAAATACAATCAATGTAATTGCATAAGAATATATATACAGAGTACACGTTGGATCTACCATGGAGA
ATGTCAACAAAAACATGTATTCGAGCTGTCAAAGTGTGTGTACTGTGTTGCGCACACAAGGCTACGATGTGTACTCCTGCCATGATTGCCAACCCACAAT
TGGCATCGCCGACGAGCAATGCCATCCGACTGGGCGAGTAGGAAAGAGGGTATTATTGCTATAAGCGCAGAGGATCCGTTAACGAGGAGGGAGATTCGCT
CAACTAACTCTTTTGAGCTGGAAATATCGCTGTACAAGATAGACCATAAGATCACGCCTCGGCGCCAGAACCGGATGTGCAGAATTGGAGATCGTGTCTA
TTGAATAATACATGTACGACTCGTACAAATTACTTGAATATCATAAAAGCTTGTCTGTACGAGTACAGACAAGCTTATCCAATTTGTTGTTGTGGCGTTA
TCTCGCTTCTATAGAGTGACGATGCTTTGTACTGTAGCATATTTGCTGAGTCTGTCGTCTGCTCAATACTAAGTAAACAATACCTCGAAGTATGCATTTG
GTTGCCTCGTGCTTACTCAGCTAGCACATCTAGCGATCTCCAATTCTGCACATCCGGTTCTGGCGCCGAGGCGTGATCTTATGGTCTATCTTGTACAGCG
ATATTTCCAGCTCAAAAGAGTTAGTTGAGCGAATCTCCCTCCTCGTTAACGGATCCTCTGCGATCTCCGTTCAAGATCCAGCATGGCATTTGATGAACGA
GGCAATGATGGTGCCCCACTTGCCCCCTTGTCACAAGAAGTGACGATGAGCTAACAGTTCATTCTTCTTTTTGATTCCAAGTGAGAAGACTACCTACCTC
GCTCTTCACAGCTGGACAAGCTACCCTCGAACCATGGTATCGAAACCCAGTATCTACCTCGTCTCGGCCGCCATTGCGTTCGTGACTCTGCAGGTGCAGC
AGACCGCCGCTACTTCGCTCACTCTCGACCCTTACACCACGTGCACGTCGTACGATATTGGCGACGAGAACTTCCCTGGCCGCGGCACCGAGATCGAAGA
CGACGGCACTTGCACTGTCACCGTCCCAGAGGACCCCAACACGCCGACATCCAAGCGCAAGTTGGAGTGGGCTAATGGCGATGATATCGCGGATCTGGAG
GCGTACTTTGGTGTCCCCATGGAGCTAAAACTTAAGAACTTGCCCACTTCGGCTGCCTACAACCCGACGCCGTGGGCCGGATCTAATTGGCCGCTCTACT
TGGACGGCATCAACTACGAGTGGAATCAAGGTCAACCGAGTCCTGCCGAGAAGTACGCGACGGCCTTTGGTCTGGATACCAAGACCTTCATGGACGGTGT
TTCCACTGAAAGTGGCGTCAACGCTAGGGCGAACCTTACCGAGTGTACAACGGACAAGGAGTGTTTCGACCCCGACATCGACATTGTTTGTGGCAAGCGA
GCTGGGGAGGCCACCGGACTCTGTATCCCGACGTGGTGGGGTATCTGTCACGCTTGGGCACCGGCCGCCATCCTCGAGAAGGAGCCCAACTGCCCCGTGA
CGTACAACGGTGTGACTTTCCAGCCTGTGGACGTCAAGGCCCTCGTGAGTCAGGTCTATAACGATGCCAACATCTCAACAGTCTTCACCGGCTCCCGCTA
CAGTGGCTACAACGACTCAATCGACGAGTACGGCAGCCACACGGACTATTCGTACCGCGACTTGAACCCCGGGTTCTTCCATATCGCCGCTGCCAACCTG
CTAGGCTTGCTCAATCACACCTTCATCGTCGATAGAGATGCCGGTATCCAAGTCTGGAACCAGCCTGTTCTCAGCTTCGAGGTCTACGAGCAGACCAACA
TGAGCACCGAGGAAGCTGGACAAACGTACTACCGTGAAGCAGAGTATCTGTGGAACCCAAACGCAACGAGCATCGTGTACGTCAAGTCGCATCTCTTGTG
GGCCAACGAGACATTCGCCGACAGTGGTCTGGTGGCTTCGGGTTTGAACGAAAAGTACACGGACGGCGCCATTTACACCTATCTGCTTGAGCTGGATGAA
AATGAGGAGATCATTGGTGGGGAGTGGCTCTACGAGTCGAGCGACAAGCACCCGGACTTCCTGTGGTTTGTGGATGAGAAGCCGGCCGAGAATACTGTCA
CCGACATTGGTCTGAGCTACGCCAACGTGACGATGCTGCTGGAGAAAGCGGTGGCGTGCTCCGAGTCGACCACGATCAAGGTTGCTGCGACGGCGTAGGT
ACTCTGCTGAGGAGTGGCGGTTAGTTTGTGGTTCATTCTAATGTTGGCATTGTTCCGGTGTCGTAGGCAAGCTGGAGAGTGTGCCACATCTGTAACTCAA
TACACATTCAACAGAGTGATGGTCATGAACGGCACTTACACGAGCAACATACCTACAGGGATGCATGTACAATGCACATTAGTACTTTGGAGAATCACAG
TAATAGTATACTATAATGTTGCGAAACGAATGCATGGTGAGGAACAGTGCCGTGAAGGATGCCATTACTTAAAAGATACTGTATGTGGCAGTCACTATGG
TTCCCATTGAGCAAAGTTTTCACGGCCGACTTGGTTACTGCAGTCACGAGACATTAGTGCGAATTGGAAGCAACACACAAAGTACTATTGCTAGTAGCAA
ATTGCTTCCTTAGAGGTCAAGGCACGTCAGTTTTGAAATTGAACGTAAATTTAGTACTATGGGCAGTAATTGTTAGCCATGTCACTTACAAGATTCACTT
CAAGTAAGTAAGAATGATTTGATTAACTAGTTAGCAGATTTCTCGTCTCTTAAACTATTGTGTCCAAATTTTGGAGCTATCTTCGCTAATCACGTTAAAC
TTGCGGAATTCAAATACCTCACACCCTTTCTGGTACTACATTCGTCGGTGACCCAAAACCTAGTCTGCGGGTCAGCATCACCAATTAGAGCGATCACAAT
CGAGTTCAGCCGCATGCTGGTAAGTAAACTGGAAGTGTTTCTTGAAAAAAGTAGTGTCCCGAGTGAGAACGGTGGACACCGTCTCGGGCACGGATGCCAC
CGTCCTCCCCCTGGAACTCGTTCGGCCTGATTGGCGAATGCGGGCCGCTACCGCTAGAGAGAGGAAGCCTGATCCTCCAAGAGAGCACGCGAGGCTTACG
CCAGGTTGCGTTGGTGCTGATGCCCGGGACGGACGGCATGGGACCAAGCTACGCTGGGCCGGACAGCGTCCTCTGTATGCTGACGTTGGAGGACTTGTAA
GGTAAGGGGTGCTAGTGAGGTCAGTCGTGATTTAACGTTGGACACCGCAGCACTACCAGAATAATCTTTTTATTTCTTTTATACTCTGGTGTTGCGTCTA
TATAGCTTTACCGTACCGTTCCTCTTTCAACCAGCAGCGTTAACCGTCCTGCCCAAGTCCGACTCGCGACAGTAGAGCTGTTTCGTGCATGTGCATGAAA
GTACACAAAAAATGGGTAGACATATTTTTTTTTTCTAAAATGACGAGAAGTGTTGGAGGTGCTGCACGCGCCCCCAGTCAGCCGTATTCGCGCCGCAACT
GCTGCTGAGACCCCGTCTACAGTTTTATATGTTGAGTTTCAGCTTTACTTTATGTTGCATGTGCTTTCAAGGCGCGTTAAATGGAATGCATGATCACTCC
GTCCTATGAACACTAATTTTGTGTTTTCTCTAAAATCAATTCTAGACATCAAAACGCTGCACAAAAGTGCACGAAACAGCTCTAGAAAGAACCTTGTACG
TTGGTGGTATTTGGAATTTGCGCCATCGATCATTACAAGAGCAGAACAACTGAGTACTCAAGGTTTGATTAACTCTTTCCATCGTCAGTGTCAACACATC
TACCTTCAAAGAATGGCCCAATTCAAAAAATATACCCCACCAAAGTGACCGATTTTGAATTCCCCGCCAATGATCAAGAAATCAAAGTCGATACCTCACA
GCTAGCGAAATGGCACGTCCATTGAAGGCCAATCCAAAATTCAAATTTTGTTTCAACAAGTTTTTTTGTTCCAGCCTCCACTTCAAGCACCGCTCAAGCA
CAGGTTGGCTATGAAAACAACCCCCCCCCCCCCCCAGCTCCAGTACAGACACCGCCGAACGTGCTTCGCCCGCCTGCAGGACAGCTACCGGACTTGTTCG
TGTATCTCCAGTCTCTTCAACGCGAGGACTAGAACTGTCACGTTCACACTGCTTCGTAGGAGTAACGAGTTTTCTTTGCCACATACATATTAATGCGTTA
ATACCACACCAATCGATGTAGTCATCTTCTTTCCACAGCTCAAGCCCCCGCTCGTCCGTGAGCTGGGAAGATCCCACGGCCAACGACCGGCGTCGCACCA
GCGTTCGCTCGAGCGTCCTGCTCGACTCCATGCGCCGCTATCCGTCCACGCTGTCGTCGCTTAAGTCCAGCAAGAATCGTCCGCACAGCTTGACCAACCA
CTTGTGAGGCTTCGTGCTACACGTCGATGGTGTCGCCCGGCACCCACACAGAGTACGATCTCGTGCTCGAGGACACGATGGTCTCGGGCGTAGGCCAGCA
GCGTGCAGAACAGTTACCTGCAGGGGCTTCTAACGCCCGCAATCTCGGTGTTCGAGCCCTCGAACCTATGATATCGACACACCGAAAGTATAATAAATAA
GAAACATTTGGGGTCGAGTGATACTGGGTGAGTTACGCTCCAACTCACTGTGCGCTACTCAGAGCGAATTCAGGGCTGAAACTTGGCACACGTATGGAAG
ACCGTTTGGTGCAGCGCACAGACGCCATTACAAGGCGAAGCCATGCGTGTACGACCTGCGCGACCGGGATATAAGCATAAGGAAACAGGCTTCAGCGAGC
AGCGTTTAAACATTTTTATTTCTGTTTAAACATTTTTATTTAAGCGTTTAAAATGTTTAAAACTATATCCAATATAATTTGCATTTAAACAATTCATAGT
ACATAATATGTACAATGAAATATATTTTAAACTCTCGAAGGCAATTATTGCAATATCAATAAAGTTCAAAGACTAAATTTTCCGCTTTGCCCACTTTTGA
ATTTTGAGATTGTCTTTCCATTTTGTTTTACTCTTTTTTTTCCTATGTCCATGATCAACAAGCAGCAAAGCAAACAAAATACGCCAAGTCCTTCTACCGG
CACGCAGTCCGCTCCGGCTGCTTGCGTTATGCGCTATCTTCCTCTTCTACCCAGAAATCTTCATGGCTTCCTCGCTTGCACCAGCGCTTACAACTTGAAT
GCCTTCTTGATGATACGATCCTGCTCGATCTGGTGCACGGCGTTGTAGCCCGTAGCGGGGGCGGCGGCAGGAGCGCGACCAATGAACGCGGGCCGGCGGG
AGTCGCTGTTGAGCTGCGTCAGCGCCGTCTCGATGCGCGGCGACACGTACGTCCAGAAGCCCATGTTGAGCGGCTCCTCCTGCACCCACTTGATGTCGGC
GTTCGGGTAGCGAGCGGCCTGCTCCGCCACCTTGTCGAACGGGAACGGCGCGATCTGCTCCACACGCACGATGGCCACGTCCTTGATGTCCTTCTCCTCA
CGCTCCTGGGCCAGCTCATAGTAAATCTTGCCCGAGCAGAAGACCACGCGCTTCACCTTGTCGTCCTCGACCAGCTTCTCCGGCTCGACCTCCGGGATCA
GGCGCTGGAACTGAGTGCCCTCAGCCATGTCCTCGAGCTTCGACGAGGCCTGGCGCAGACGCAGCAGGTGCTTGGGCTGCACCGAAATCAGCGGCTTGCG
GAAGTCGCGGTGAATTTGGCGACGCAACACGTGGAAGTACTGAGCCGGAGTAGAGCAGTACACCACCTGCCAGTTCGTGTGCTGGATCTGCATGCGATTC
TCCTCGTCCATGAGCGGCACGACGTTCGGGTCGTCGTCCGTGTTCTGCAGGTAGCGCTCCACGCGGCACGACGAGTGTTCAGCACCCTGGCCTTCGTAGC
CGTGCGGCAGCAGCATGACGAGACCCGACTGACGCATCCACTTGTCCTCACCAGCGCTCAGGAACTGATCGATCATGATCTGAGCACCGTTAGCAAAGTC
ACCGAACTGAGCCTCCCACATCACGAGGGCGTTGGGGTTCTCCAGAGAGTAACCAAGCTCGAAACCAAGCACACCGAACTCCGACAGTGAACTATTGGAC
GCCACAAACTCGGCCTGTGTGTCGGGCACAACGTCGCCGCCAGGGGTCTTGTACTCGAGAGGAGCCGACGGGATCGTCTTATCGGCAAGGTTGTTC