Description :
From Genome Similarity Track
Location :
Scaffold_1289:1065- 5919
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1289-snap-gene-0.3Ubiquitin carboxyl-terminal hydrolase and/or F-box protein
Pytar_ATCC12531snap_masked-par_contig_1289-abinit-gene-0.5Gene of unknown function

Sequence
4854 bases(100 bases per row)
CGTCGTCGTCCACGTACTCGGACTCGTTCCACCACTTTGTGCGCACGCCGTCCGAGATGCGCGGGTCGCAGCTCAACGCGTTCAAGCCCATGGTCGACGA
CGACGCGTACGCGCAGCACCACTTGCGCGTGTCGTTCCAGCCCAACGGCAGCCTCGTGCAGCAGGCGCACGCCGCGAGCGACGAGATCGTCAAGGTCGAG
ATCCCGCGCTGGAAGTCCAAGCAAGTGGATCTCCAGGCGCGCCAAGTGCCGCCGGCGCCGGTGCCGTCGCCCCACATGGGGCTCGGGCCTGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGGGCGAAAAGGAATTCCCCCGGCGAGACAGCAGCAGCG
GCGTCGCGCTGGAACGCGACTCGTCCACGGCCGCGTCCATCCCGCGCAGCTCGGGCAGCAACAGCAAGCGGTTCACGGTCTTTCAGGTCTACGTGCACCA
CCAAAGCGGCCGCGTGACGACGCTCGAGAAGCGCTACTCGCACTTCCGCGATCTCCACAAGATTCTCCGCGCCAAGTACGCGACCGTGAGCAAGCTCTAC
TTTCCGCCCAAGAAGTTTTTCATGTCGCTGTCGCTCCACGTGATTGAGCAGCGCCGCGAGGGCATTGAGAACTACCTGAATGCCGTGCTCACGCTGCGGC
CGCGGCCACTGGAGCTCGTGCGCTTTCTCCACGGCATGCCCACGAACGGCGCCGCGGGCAGCCTCCCGCCGCCCACGAGCAGTACGACGCCCCACCACGC
CACGGGCTTTGTGGACACGGCCGCGTACACGACGGCACCGTCGTCGATGAGTAATAATGCCACGGGCAGCGGCCGCGGCACCACAGCCTTCACGCACGTG
CATGGCGACGACGACGACGCCAACGAAGTCGACTTGTTTTCCGACCTGGGCAGCGTCCACAGCCTGAGCGCGAGCCGCGGGCCGTCGTTCAGCGCTGGCA
GCATGCTCCACCGCGAGATGTCGTCGCCCGCACACCACCCTGCCGCGCCGCTCGTGGGCATGCAGGACTTCGAGATCCTCAAGATGCTGGGCAAGGGCTC
CTTTGGCAAGGTGTACATGGTCCGGCGCAAGGCGGACGGCGAGATCTTGGCCATGAAAGTGCTGAGGAAAAGCGAGCTCGTGAAGCGCAGCCAGGTGCAC
CACACCATGACGGAGCGCAAGATCATGAGCTCGGTGCAGCACCCGTTTGTCGTGTCGCTGCGGTACGCGTTCCAGACGCAAAGCAAGCTCGTCATGATCT
CGGACTATTGCTGCGGCGGCGAAGTGTTTTTCCACTTGAAAAAGTTTCGCTCCTTTTCCGAATCCATGGTGCGCTTCTACGCGGCCGAGCTCGTGGCGGC
GCTGGGCCACTTGCACGCCATGGACGTCGTCTACCGCGACCTCAAGCCCGAGAACATTTTGCTTGACGACCAGGGCCACATTCGGCTCACCGACTTTGGG
CTCTCCAAGATGCAGTGCTCCGACTTTGCCGGCGCCAAGACGTTCTGCGGCACGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNATGCTCATTAGCCGCAAGAAAAAGACCGAGTACGGCAAGGCCGTCGACTGGTGGAGCCTCGGCACGCTCATGTACGAGATGCTCACG
GGCTGGCCGCCTTTCTTTGACCGCAACATTGAGCAAATGTGCCAGAAGATTATGAAGGCGCCGCTCAAGTTCCCGTCCCACTTTGGGCTCTCGCCCGAGG
TCAAGAACCTCATTGCGGCGCTGCTCGAGCGCGACCCGGCGTACCGCATTGGCTGCCGCTTTGGGGTCGGCGTCGAGGATATCAAGCGCCACCCCTTCTT
TGCCGAGATTGACTGGACGCTTCTCGAACGAAGAGAAGTCAAGCCGCCGTTCAAGCCGCGTGTGCGATCGCCCACGGACATCCAGAACTTTGACAAGGAG
TTTACCAAGGAAGCCCCGGACCACCACTTTCTGCAGGTTCGTTCTTTTTTATTTGAGGGTGCATTCTATTTTATTCTGGATGGTGCACTGATTCGATACT
TTGGTTCTCTCCTTACAGCAAGATACGCGGTTGCTGGTCTCGCCCCGCAACGAATTCCAGGGCTTTTCATATACGTACACGCGGAGCCCTTCGTTCTCGT
CGCGTGCCAAGGCGGCATACTACGCGAATGACCGGCGCGAAAGCGAAGAAGGCTACGAGTCAACGGCCACGCGGAATTACTCCATTTCGTGAGCGCGTCG
TGTGTACTCCTTGTCAATTCCTGGGCCTATACATACGCAAGCCGCCCCGCCATCCGCTGCGCGGCAGCCTCTACAAGAACTTTCACATACAGACTTCCCA
TCTTCAAGCTCTACGAACCTCTGGATTCCGACGAAGGGAAATCGCGCGTTGGGGCGATCCACATTTATGGGAGACCCCTCCTTCACAACCGACCACACTG
CACCCCATCGAGAGAAGAGAAAAGAGGAGAAAGAGAAGTGAGTCGTATAATCGATCGATGGGGGGAGTGGATGTGTGGGANNNNNNNNNNGAAGAGAAAA
GAAGAGAAAGAGAAGTAAGTCGTATAATCGATCGCTGGGGGGAGTGGATGTGTGGGAATGCTAGAATACAAAAGACATATCAAGAAGTCGTTCGGTCTCA
CCACGCCCGCGCGGCGGCCGACGAACTGCCCCGGCGTGGCCGAGGTGTGTAGTCGTAAAACACGGGCAGCATCTCGCGCGTCGCGTGGCTCGTCTTGTGG
TGCTTGAACTCGTACACGCGCTGCCACTTGCCGTCCACGTTGGCGTATCGATGGCTCACTTCGTGCGACTTTTCTGTGGTCCAACGCAAAGCCAAGTCAG
TGTTAGCTTCTCGCTCTGTCACGGACCAGAGTATATAAGAGTACGCACCATGGCACTGGCGGCAGAGATCATAGTCGCTGCACACGGTGCAGTTGAACCG
CGCACCCTTAAAATCCGTCTCGCCGCACGAGTCGCAGATGAACCCCAAGTGGCGGCCCTCCATAATGTACCGCAGCGTATTGCGGCCGTGCTCGTGGCAC
TTGCGGAACGCACTGCGCACGCGAAACTTGGGGATGTCGAGCCGCTCGGCGAGCGTCTCAATCTGCGCGAGCGTCGGGGCCGTATAGTCGCGCTTGAGCA
TGCGCTCGGCCGCGGCGTACTGGCGATGGAGCATGCCACGCATGGCACGGTCAAAGACGCCGCTCGCGACCGTCGCTCTGTGGGTAAACACGACAATGTC
GGCGGCCTGCAGTGAGACCGCAAAGCCACCTTTCCCGGCGCTGTCGGTGGACCACGCGATCGGCCCTGAGTAGAGCGTGGGCGCGATCTCTTCCTTGAAC
ATGCAGAGATCGTACGACGAGCAGTGGAGCCGTCGCGCGGCACACTCGTAGATGGACGCCGTCGAGAACGATGCGCTCGTGGCGTGGAACGCAAAGCGGC
CGAGGTAGAGAAACTCGAGCGTCTCGGGGTCCAGCACCTTGACAAAGAGGTACGAGGACGAGGACGAGGAGGAGGACGAGGCGTTGAACGCACTCGAGGC
GGACGTTGACGACGAGGTCGGGGAGAGCGACACTGTCGAGTGCGACTCGCTCTCCATGTCGACGTCGTCGTGGTCGTCCATGTCCGTGGCCATCGTCTCT
AACTCCATTGCGTTCAATACTGACTCGTCGTGGTCGGGGCTCTCGACGTACAGCAGACAGAACGAGTAGGCGTCAATGTCGACGCCGTCGCAGAGCAAGT
TGCCAAAGAGCGGCAGCGTCTCGCTGGCCGGTTTGGCCTGCTGCGTGAGCCGCTTCCGCGGCCGGAGAGCCTGGCCCGACACCACGGGCTGGTTAAAGCA
CCACACGCGCACGGTCGCGGGGTCCACCCCGAATCGCTCGGCGAGCTTCTTGAGCAGATCCTGGAGCGAGCAGCAAAACGGCAGCTCGAGCGTCGCGGCC
GCTTCAAAGTCTGCGAGACCAAGCTTGCGGTGGCGCGCGAGGTCGTGTTCAAACACGACGCGGAACGTGATGCTCATGAGCCGCACATTGGCCGTGACCG
TGAGCGCCTCGTTCTGCAAGTAGCCACTCGCGGGATTGCGCAGCGTCTTGAGCGACCCGAGCGAGTGGATGCCCCAGTTGTGGAGCGTGCTGTCAAACTT
GTTGTCGACGAGGCACGAGTGCCACTCAATCTTGCGCGACGGGTCCTTGTGGTTCACGACCGCGAGCGAAAAGACGGCGCACGTGAGCCAGTCGGGCGCG
CGGTCCTCCAGGTCCGTGAGCACGAGGTAGACGCTGAGCACGCGGCCGACGTACTGCGGCTCGTTCGGGTTGCCGTTCGGGAAGATCCAGAGGCAAAAGC
GGTGCTCGCCAATGGCAAACGTCTCGGACACGACCTTGTCCACGCCGTTCGCGGCCGCGTTGGCAAACTGCGGAATCGCCACGCGCATCTCGGCGCGCTG
GTCCAGTCGGTGGCGCTCCACAAAGCAGCGGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGC
AGGCGCCAAGAGGTCAGGTCAGCTCCGTCTCAAAGATATCATAAAGAAGAACAGAACGTACATCGTAGTCGGGGGCGCCGGGCAGCTGCGGGAGGATCTG
CGTGCGCAGCGACGGCCACGTCGTCATGCAAATGTTGCGCCACACGTCGCGCGCATGCGAGAGCCGCGCCATCGTGCGGCAGGTCTCCGAGCAGCGCAGC
AGCGACGGGCCGTCGGCAAACGCCAGCACCTGCGCGACCATCTCGCTGGGCAGC