Description :
From Genome Similarity Track
Location :
Scaffold_2:1064944- 1067427
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000798Similar to DDB_G0271670: Uncharacterized protein DDB_G0271670 (Dictyostelium discoideum)

Sequence
2483 bases(100 bases per row)
GCCGGGGACGAGAAGGACACGCAAGCAGCCAAGAACGGCGAGAACAGCTCAACGTCGGACGACGATGACTCGTCGTCCTCGAGCTCCGGGTCGTCGTCGT
CGTCAGACTCGTCCGATTCCGAGTCTGATGGCGAAGGCGGCGAGAACCAGCAGCAGCAGCAGGATGACCGCGACTCGAACTTTGGCGATCGCAAGTACAG
CATCGAGAGTGTGGCCAGCAGCAACGGCTTTGCGTCTCAGGGGGCACGGCAGAGCGACCGGAACCCAGCCGAGCCTCTCAATGTCAACTCGAATCGCGCC
GCGGCGCGCTTCCGCGAGCAAAACTCGGAGGTCGGACTCATGGCGCTGGGCACGAAGAAGCGCGATCGACGCACGATCGAGGAAATCCAGCGCGACCTGC
AAAAGCGGCGCGGACGCGGCACACTCTCCTCTTCAAACGGGGGTAGTTCGTCGTCGTTCACAGCCAGCAAACCACCCATGTCGTCGTCCTCTTCCGGTGT
CATCACAGCGCGCGCGAGTCCGCCCAAAGGGTCGCCCGTGCTCTCTCCGGAACCTGGGGATTCGTCCCAGTTGACAGTGGGACCTCCACAAATTAAAATG
CCCAAGGGAAAACCGAACTCTGCGCGATCACGGCTCACGATGAAGCTCTTGGGTCGCGGCCGCTCCAATCCAGTGCCCGCAGCGAAAGTCCCCATGAAAA
AAGTAAGTACGACGACGTCGACGCCCGGCACGGGCATGGTGACAAATATATCGGCTGGCGCCAAAGTCGCCACCAAGGCTGCCAACGATCTGGGTGAGTT
TTGCCACAGCAAGCCAAACGATGGATGTTGAACCCAGTATTGACTCGTCCCCTCTTTTGTAGATTCGTACGTAGAGCAAAGATTAGACCAAGCTCCTCCA
GCAAGGCAGCAGCAGCTGGAACCAAAGGTCGAACCGAGAGTCGTAGACTGGAAACCCGACGGGAAGGTTGTGCGCGCGCTGCTCCGCGGCATGCTGCGCT
TTGGTGATCTCACCGACGTCGGCATGTTCAAACTGGATCACCCTAATTCGTTTGCCGATGAGTTTAAATTGCAAAATTTCGTGGTCCGTTCGCATCTTCC
GTCCTCGACAAAAGTGTCGGAGGAGCAGCTCCTGAAAACGGCCGCAGAGATCTCGGAACGCGCGCAGCGAGCCATCGAAGACAAGCAGGACAACATGAAA
TACGCAGACGTCGAAATCAAACCGAGCCAAGTCATCGAGCGACTGTATGACAACCTGAAGCTGAGAGTCGCAGTGCAACGCGCGCTGCGTGACGCAAAGT
ACGCCAAGCGAGACGACAAAGGTGCGTATGTACTGGTCGCGAAGCAGTCGGACCTCCCCGTGCTAGGAATTTCTCGCGATTTTCCGCCATGGTCGTGGGC
CGAAAAGGAGCATGACTGGAATAGCCGGAAGGACACGGCGCTACTGCTCGGCATCTACGTGCACGGGTTTGGCGCTTGGGAAGACATTTTGAACGACGAT
CTTCTCCATTTCCACCAGCAGCGCGCGTTGAAAGGCGAGCGCATGAAGAAGCGCGCAGAGAATCTGCTCAAGCGTCTTCCTCCACCTGACGAGTCTGGAG
ACCCGAAGATTGTGCACAATGCGAGTGTGCTGGTCGCTGGATCGCAGAACTCGGGGCCATCACTCGGTGCCCAGTTCAGCGCGATCATCAACAGCAACAA
CCCGAACAAAGGACGGCTGGAGCGCGCAGCGCAACGCTTTGCCGCGCGTCAAAGCAGTGGGGCCTCGTCCATACCTGAATCCCGTGTGGTCGCCGAAGAT
TCCATTCGACGCTCGCATACCCAAGCTAACAGCAGCAGTAGTGTCAGTAGTAGCAGCAATGCTCCCGATCGGCAGCGGAAAACCTCGATCCCGTCAAGCT
CGCCGCGAAACGACGAGCCAGAAGACGGTGAAGTTGGTGGAAGCTCATCCGCTGCTGCCAGTAGTACGGCTGCTGGACGCTCGTCGACTTCCTCAAAGTC
ATCATCTTCTAGCAAGCGAGCGGCGTCCATAGAAACGGAGCAAATCGGCGGCGGTTCGCCGCGGAAGAAGAGCAAGCACCACAGTTCCGAGCGATCACGG
AAGCATCGAGACCGAGATGCGTCTTCCACCCCGTCGAAGACGAAGAAAGCGAGGATACTCACAGAGGAGCAGTGCGTGGAAAAGTGGAAGCCGAGCAAGA
AACTCAAGGATATCCGCCAGGTGCTGAAAAAGATGAAGATCATGGCGGACTGGTCAAAAAACCAGACAGACGAAGTTGTCGTGGAGAAAGTGTGCAAATA
TGTGATCACGATCGGCGAAGCGATCGACGACATTGTGCGGAAGGCCCAGAAAGACGGCGAGCAATCGGATGCGGCCCACGAGTTGGACGAGTTGTGCACG
TGCCTGTGGTCGTACGCCGCGGGGTACACGCCGTTTTCGTCGCTCATCTTTGAGCGTTTGTACGACGACATTTGCGCGGACGG