Description :
From Genome Similarity Track
Location :
Scaffold_575:10647- 11803
Sequence
1156 bases(100 bases per row)
TATTGTCATCTACCCGGACTCGGTTCAGTCGGTGGTAAAGCCATTCGTCTCCGTGCTCAGTGTCGCGTACAACACGGTCCCGAGCTTCTCACGGGACGAA
AACACGGGCAGATCCAATCGGTTGAAGCACGCGTGGCTCCAGATGTGCCCATTTATCGTGTTCCCAGAGGTTGTTGCGCCTTCAGAGCCCTTCAGAGTGA
ACGGACACAGTCGGCCATCATTGCTGGTTAGTGCGCTAAATCCCGCGATCGGGACACGCGAAGAGCCCGTGGCGAAGAGCAACAGCCGACGGCGATACTC
GTTGGGCATCTCGCGCACAATCTCCCAGAACCACTTGACGATATACTTGCGATGACTTTGGAGGTTGTCGGCAACCTGGGTATGGCGCTCCCAATCGTCC
ACGTCGATCTCTTCCGAGCCGCACAGCACGTAATCAAGCTCTTCGGGGTCAAACAGCATGAGTAGTTCTTGCGGCACCACTTCGTACAACCCTTTCAAGA
ACACATACAGTTGCGGCGCTACGCTTTCAAAGAGCAGGTACCGTAACTTACACTCCAAATACTCGTGTTTGTTCTCGTCCGTCACCTCGATTTGCTGCCC
ATTGGGGACAAGATCCACAGTAGCGAAAATTCCGCCACTGTTCATTTCCGTCACACTGAAATCAAGTCCAAGGTTCCTGATACCATCATTCTCGCGAATC
CACAGCATACTTTTGTATGCTGCTGGGTCGAAATACGCCAAGTCACTGAACGCGATCGGTAAGCCCAAGATGATCTTGAGAAGTGGGAGAGCCAAGTGGA
AACCTAATACTTGACCTTCTAGCAACGCTCGTCCTACAAGACGTCCCGTCGCAAAGTAGTACATAAGGTGGTCCTCACCAATGTCTGCCGCGGAGCTTGG
GTTCAGGTAAAATGTCTGGTCGACTGGGTTGACGCAGCGAAAGATACCGGCCTCTGGCTCGGCCAATTTGTCGTTGAGCAGCATAAACCACTCGCGTTGG
ATGCCTCCGGCGTCCAGTCCAGGCTCGTCGAGGAAGTGGATGCGCATTGACGAACGGATGCTCTCTAAGGGAATCACACTGAGAGACTCCATCGAGTCGA
ATAGCAGTTCGCTTCGATTGACTTTGAGCTTCAAGATGTGGTGACGACCAGGCTGC