Description :
From Genome Similarity Track
Location :
contig_19:10646- 11729
Sequence
1083 bases(100 bases per row)
AATAGTGGCAGTCCATTTCAATGGACTTTGTTTTTGATCTTCCGCAAGACAACAAGCGAGGACTGGTATTGTGGTCTTGTTGGCCGCTTCAGCAAGATGG
TACATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGT
GTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACATTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACC
GACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGACCGACTGCTTGCCGATGGCGGAGT
TCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGC
TCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACGAGCAATGTATCAGCTGTGACGACTCGCGCACGTACT
GCGCGCAGTCATGGCGACGACAACACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGG
AGCACGAACTGAACCAGGAGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGT
CGATCGACAGAAGCTGAATGCCGATAACACAGGCAGAGGAAACACAAATGAATTTAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAA
CATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATA
CCGTCCAGGATGCGTTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAATACGAGTCACCTACGTCTGGTGA