Description :
From Genome Similarity Track
Location :
Scaffold_159:106453- 110579
Sequence
4126 bases(100 bases per row)
AATCACGCCTCCTACACGATCTGTGGGAGCATGCTCACCAGAGTCCTTGCTCGATTGTCTGTTCTTCGTCTGCTTGCCCTCGGCACAAGTCAGACAGTTC
ACTCTCCGTCGATCGGTCAGTTCGATGCCGGAGCTTGGCTCGCGTGCCAGCCGCTCCACGGCATCATAGTTCAGGTGCCCGAGACGTCGATGAAACTCGA
CCAGCGTGCCCTTCTGCACATTGCTCGTCTCGCCGTCGGTCGCCGCCACCACCTCAGTGAGCGCGGCCATGATCACGTCTGACGCGAGTTCGCGCTTCTT
CTTTACCGATCCGCACACCATCAGCACGTTCCTTCGTAGCTCAACGTCAAAAGCCACATGCTGTCCATTCTTAGCGGCCACGACGCGTCGTCCATTCTTA
TAGGTCAGTGTGAAACCTTTTTCGTCTAATTTTCCGTACGATATCAAATTATGTACGACGCCCTCGGCGTAGTACACGTCCGTAAGCTTGAGTGTCTGCT
CGGCACCGCATGCCGAGACTCTGAGTGTCAGTGTGCCCTTCTTTCTTATGCGCAACGGCTCACCGTTGGGCTGCACACACACGTCCTCGCACTCCTCCAC
TTCGTCCAGCCAGGACTCGTCACTGACTAGATGTCTACTAGATCCACTGTCCAGGATCCACATTTCCTCGGTCGCAACCGTGTCTTCCTTTACGGCAAGG
GTCAAATCCGGTTCCCCGTCGCCTCCTCGCCCACGCTCCGGACACGCTGCACGCAGATGCCCAACTCGGCCACACTCGTGGCATTTACGCGTTTCTCTAC
CACGCGCCTCGCCAACTGCTCCCACCAGCTCTTTTCCAAGACTCCGGTGCCTTACCGGATCTAACTCCCAGGCCTGCGCGAAGTGAGCCAGTTCTTCGGC
CTGCTGCAGATAGTCCGTCCTGCTCGCGTCGACCTTGGCCATTAGTACCATCCGTAACTCAGGAGACGCGTACTGCACTATATTATTAAGTGCAAGATAG
TCAGCTCCGCCGCCGCACGCTTCGGAGATGGCTACGAGGTACATATAGTGCTCCGACCAGTTGCGTTTAGCGTCCTTTGGTGCAGTGAAGAGCTTCATCG
CCTGCGCAGGCGTGATATTCGTCTTAAATGCTTCCAGCATACGTTCCATAACGTGATTTGGGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAG
CCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTAC
CTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTGACGGTGGATCTA
GTAGCCACGGCTAATGAAGAGTCAAGATCCACCTCGAGGTACCCCGGATCCCATACTCCTGAGTTCGTATCCAAGGAGGGAGGATCCCGCCTTGAGGGAC
CTGGATCCAGGGTATAGGGATGAGGGATACAGTGGATCTCGAACTTTCGTGGGACAACGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATTGGAG
AGCTCGGATCCACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGT
CATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCAAGCCTGGTAAGGGATTTAGCAGATGAAAGA
CATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGTCCTCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAGAACCGGA
ACTACATTGGCCGTACGAGCTCCAGAGAAGATTGGGAATTGCGAATCTAGTGTTGGTAGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCTTGTGTGTT
CCACACCATGTAGCCCCGTTACACTCTCCCCCACTAAGATGAGAACATTCCGTTCTTGAAACTCTCCTCAGCGAGGTCACGTCTTGTTAAGACGGCGGGG
GTTACTACACCTCACACCAGCGTTGTACAGCTCCGTGAGCTCACAAACGCCTACGCATCGCTGATGCCCAACTTCTCGTTGTCGGCCCACGGCCACATGC
TCCAAGCGCAGCGCGCATCTTGCTCTCAAGTGGTCTCAGACCTACGCTCGCGCTCCGCGCCTACTCCAAGAGCTGCAAGCCGCTTAGAGCAATGCTCTTG
ACTCATTCGAGTCGTCGACAACAGCTCAGCGGTTGAACAGTCGCTTCACAAGCGATAGGTCGGCGGTTCGAACCCACTAGGGCACAGCCCTCTCGCTCCA
TGAACGGTTGTTCACGCTTGGACAAGCTTAAGAGCAATCCGCTTTTAGCTCAGTGGTCCAGCGTTGGCTTTGGAAGCCACAGGTCGGTGGTTCGAACCCA
CCAGGGCACAGCCCTCTCGTTCCATGAACTGTTGTCCACGCTTGGACAAGCTTAAGAGCAATCCGCTTTTAGCTCAGTGGTCGAGCGTTGGCTTTGGGAA
GCCACAGGTCGGTGGTTCGAACCCACCAGGGCACAGCCCTCTCGTTCCATGAACTGTTGTCCTTGAATGGACAAGCTTAAGGGCAACGTCCTTATAGCTC
ATGGTAAAGCTCCGGCCTGTCAAGCCAAATGCCAGTGGTTTCGATCCCCGTCCGGGACACCACTTTCGCTGTTACAGCGCATCCACATTTGGATCATGCT
CATCGAGCAAGTTGTTTCAAAACAACTATGCGTCTATCGAGACGCTTGTGCCTGAACCTTGTTCAGCACAACACGAAGCACCTGCTTCCTTCGGGACCAT
GTCCCTAACACTACGAGGTCTCTCCACCTCCTGCTCCCGCTGCGAGCACCGCTCGTACGTACGAGCTGGCTGCTGCAGCCACTGGTCAGAGCCTGAGCTC
AACTGACCTGATCGCTCCCCACGCTAGTGGGAGGCGCCCAGCGCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGGCACATGATGTGCCCGGTCGT
AAGCGTCAACGACGTCAGGGCAATCTTGCCGGAGGATAACCTCAAACTCCCATGAGTTCTGTGAGTGAGGGTAACCCCTTGTGGTGAAGTGCTTTCTCAG
AAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTTGC
CTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTC
GGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTC
TGACGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTTCTGAGTTCGTATCCAAGGAGGGAGGATC
CCGCCTGGAGGGACCTGGATCCAGGGTATAGGGATGAGGGATACAGTGGATCTCGAACTTTCGTGGGACAACGGAGATCACAGACGGTTGCGAGATGATG
TTGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGAC
CATGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATT
TAGCAGATGAAAGACATAGAAGGTAG