Description :
From Genome Similarity Track
Location :
Scaffold_4:10643- 14619
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_4-snap-gene-0.68Nuclear pore complex protein Nup93
Pytul_var.sporangiiferummaker-pug3_contig_4-exonerate_est2genome-gene-0.1Gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_4-abinit-gene-0.127Conserved gene of unknown function

Sequence
3976 bases(100 bases per row)
TGGATGCTGAGACTCGCTGGATGAAGCACAGACGCTGCCACAGGTAGTCTTCGATCGTCGTCAAGATACGCGGCTCGCTAGCGTTCGGGTTGCCAAAGCA
CAGCAGGTTGATCACGCAGCGCTCGTACGGGTTTACCACCGAGATCGCATCGATCGACGCACTCGTGAGGCGATGGTATCTGTCAACCAACTTTTCGTAT
TCCGATGGGAACTGCTTCGAGAATGCGCTCAATGGCGGCGCGTCGCGATCGGCATACGCTCGCTTCTGGTGGACGCGGTATTTCAACGCCGCAAGCACGT
TCGCGTCAATTGCGGCATCCCCCGTACGGATCGAACTGTTCACAAGATCGATTGCCTCTTGATCACCACCGGAGCGGATGCAGTAGTACAACAGCGCCCA
GATGTTGGCATCCAGATCCGTGTTGTCGCTCGATCCGTTGACAGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTCTGCAGGTAGCGAAC
GAAAGCACGAACGTTCGACACCAGATCTGGCACGCCGCCCGTCGCGAGATGGTTTTTCTGCACCGTCTGGTACACAAAGCTTCGGAATTGGCTCGNNNNN
NNNNNGCGCGCACCAAAAGCAAAGCGATGTTGCAATTGCTGCGCGCCAGTCTTGGCGAACTCGCGTTCGTACAAACCAGCCGAGCGCGTTTTGACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGACACGTTGTCAGCGACCACGCGCTGGAACGCGTTCACGAGATCGTACTGGCTGCGCGTGTTCG
GCACGCGGCTGTTGTTCAGCTCCTTCACGATGCTGTAGTACTGCTTCATCTCTTCCGTCATGGAGCTCTCCACGCTGAGTTGCGACATACGCAGTGGAGC
ATCCGCAGCAAATGTCGAGCCGGATTGCGCAAGATCGAAGCGACGCTGCCCGCCGAATGGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NACGATCCGTTGCTTGCATCGCGCTTGGCAGCATTGGCCGGGATCGCAAACACGTTGCCACGGTCGTCTTGCTCCAGGATGCGCGGGTAGTTGCGAATCC
CGAGCTGCTTGGAGCCACCGAGGTCTTCCAGGAGCCGCTGCTTGGCGATCTCGAAATCGTCAATCATCGCCTGGTTCATGCGGTCGTGTGTGGCTTCCAT
CGTGCGTCGGTTCACGTCCTCAATCGCCGTCAGGATGATCATCTCGTGGTGGTGGGTCAAGTAACCCTCAATATCGGTCTCGCCCAGCGGCGTCTCTGGC
TGAAACTCGGGCGTGATCTCGAACGCCTGCAGCTCCTTCGACAGCTTCTCTGCATCGATGCCCTTGGCCGCCAGCAGGAAGTTCGCCTTGTCGATCCCCG
TCGACGACGTGCTCAGTCCAGGCCCACGGCGTGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCTTGCCGATGCT
GCTTTGCTTCTGCTGCTGCTGTTGCTCGTTGAAAAATGCGCGCGACGCATCATCGAGCTGCTCAAGTCCTTTCTCCAAGCGCGGGATGCCGAAATCATCG
ATCGCGGTCGTGAGCTTGAGCGAACTCTGGTACAGCGCCTTGAAGTCAATGTCGCCCGACGCCATCCCTACTTGTTCTCTTATTTGCCGTCACAGAAGTG
CTCTTGTATCAGAAAAAGAAATAGGTATACACGCGCAGAAGCGGGTGCTGAAGACGATGATATGCGGATGGCTCCTGATAGAGAGACGCACACGCACACA
ATCGATAGCGACAGAGAGGGGTTGGAGCGCTTGGAGCTAGGTGCGAATGGCTTGGGAGCGCGCGCAATATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTGGGGGGAAGGAAACAAAACCCACAAACCCATCAACCCACCCGCCCAAAGGATTTCGTACTTTAATGAAAATAAAAGTAGTACACAATTCGTAC
TTTGAAGGACTATAACAGTATATACACAAAAATCCCGAACGGTCCTGTGCGTCCCGAATGCGCGAAAGTTTTGCTGGTTTTTAGAATGACAAATGATGTT
CGGGACACAACGATCTGCATCCCTGATTTCTGTTTTTTTCTTTTGCCTCGTGTTGGCTTGAAATTCGGAAAAAGGAATACCGAGTCGCTTGGGTGGATGG
GTATGAGGAAGAAGCATACCGCAAAATAGCAAAATGGAGCTCGACACAGAGCATGTCCATCTTAACGGGCTACATGAGCATCGAATAGCCATTGCTGGTC
TTTGTTGTCTCCATCATGCACACCGAAGCTGCGTGCGAGTGTTCTTAATACGAAAGATCGGAGACTGAACCGTCTGGTCCGACGTCATGACTGGCGCCGA
GTTACTAATGGGCACAACTATGTACGGAGTCAGAGCGTGGAGTAATTAAAAATTTGCAAATGCTGCCACTGTCTCAAGCTCTGGACAGTTATACAGTTGT
GCGTCGTACCGCCACGCGGCAACTGTTGTCCTTTGAATCATCATACTAGGGATACAGTAGAAGAAGAGATCCGGTGCAACGTCGTTGTCGACTATCGTTG
CTCTCGTCGCTCAATCTGGTCGTAGCACACAACTGCGCATAATAGTAACATCGTGCATGGTGCAATACCTAGTACAATCGGACGCCATTGGCGTCGTACA
GACTATTGAAGCAGTCGGCGTAGGCGCTCTGTACCAAGAGCTTCTCTCTATAATAATCCGTAGCTTCGTGGGTAAAAAATGATCACTCTTGGTCTCAGTA
TGCGGGTCAAGCGACTGCCGCATCTCTCTACCTCCAAGAGACAGTCAAGTCGACCAGACTGGCTGGATTACAGCCTCGGCGGTATCCCGAATCAAGATCC
TCCAATTCGGGATTTGGTCCCGAATTCCACTGAGCGGTTGCCTTCTCTCTCTATCGTCAATCGAGACTCGGGCGGCCCCCGCATCCGCATTCTGCGTTCG
TACTTCATATAGAGAAAAGGCGGGCGGCGCGAAGGGAGAAGCGCGGCGTGGACGCCGACAAAGAACCGAAGGAAGAGGAAGCACTGCGTGTGTGAGTCAC
TTTCTCTCTCTCGCTTTCCCCGCGTGTAGACGTCCCCCGACAAGCGCTAGCGAGAGGGGACGGGGGGACTGACTGAAAACCTGCGAAGGTGCGTTCTTGA
TTTTCTGTTGGTGTGGGTTGAGAAAAGGCGACGGTTGACTGCACTGCGCCACACGTGTGATTGAGTGTGTTTGCATGCCTGATGCTGGCCGGTGTCGTAA
CCCGGGAAATGTAGGAGGCGACGTGTATTCAACAGTTGAACTAATTTTAACCCTTTCTTACGCTTTGGGTGTCGGATACGATAGGGTGTGGATCGTGGGT
GAAAGCGCTCATCTTTGAGTGAGGAAGGAAAAGGAAAATAACGAGCAAGGCGACGATGGCGTGGGCGTGTAAAGCGTGTGAATACCCGAACGAGGATGAG
AACGCGGATGTGTGTCGCGCATGCGGATCGGAACGCCCGGAAGATGACCAGAGCACGGTGAGCAACAGCAGCAGTGGCGGCGGCAACGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGATCGAGTTACCGGCGAAGGAAAAGCTTGGTGTGAAGCTCATGCCTCCGAAAAAGGGTGTGATCATCCAC
GGTTTGAGTATCGATAACATCGACAACCCGTTGCTGGAAAACAAGGTCCAAGCTGGAGATTTGATTGTTGCTATCGGTGGCAAAAGCGTCGACAACATGG
GTTTTTCCGATGCGATTGATCTGATTCGTAAACTGCCTCGTCCGCTTGCGATCTCGTTCGAGATTGATGAAGAACG