Description :
From Genome Similarity Track
Location :
Scaffold_659:10643- 12469
Transcript NameFunction/comments
Phypl_g10131hypothetical protein

Sequence
1826 bases(100 bases per row)
ccagagaaagaggagggggggggcaggaggagacgcatcaagaagaagcggctgcggctgcatgggggcaacagcagcagcgacgacgcgtcgtcAGAAG
GCAGCGGTGATGCAAAGGAGAGGAAACGTAGACGGGCGAAGAAATCCGTGAAGGCGCGACGCGAACGATCTATGGAGGTGGGGGCCAAGGACTCAAAGAA
GGCGGAGCCGCGTGTGGACTCAGCAAAAGTCAAAGCGGCAGCCCTGAGGGAGCAGCGGGTGCAAAAGTTGCACGCCCTCCGAGTGACCAACGGAGAACAT
GACAAAAGGGCCGCCTTCAGGCTCAAGCGACAGGAGTCGGCTGAGGCGTTCAAAGAGAAGGAAAGGAATCGTATGCGAGCGATTCGAGCGGTGCGTGATG
CTCAAAAGGTTTCAGTTGGGGCGGAGGCTGATGTCGAGGATGAGGGgggaggccgacgacgaccacgatcgcgtgctggagctgacaAGGGCACTGCAGG
CAAGTGTGCGAAGCGTAagcgcagagctgctgctttgaAAAAAGAGGACAGCAAAACTGAACAGACCGACTCTCCTACTGTCGACGAAGACAAATTTTCC
GCTTCAGTGCAACCTGATCGTGACGACGAAAGCGAAGGGAACTCTAGTGCAGGGGCTAAGGCCGTTCCTGTGGAGCTAGGGAAGCACGAAGACGTCAAGA
CGGAAGGATTGGTGACGTCCCCTGAGTCAGTAAAACTGGAAGACAAAGAAGGAGACTCTTCTGCGGCCACAAGAAATACGCCGGTTAAGCCAGAAGGTAG
TGTTGGGGAGTCCTATGCAGCCATTAAAGGGACATCTTCTACACCAGCGACAACTGAAACCAGCGTGAAAGCAGAAGTCAATATCTCTGAGGGCGCCAAA
AGCGAATGCACAACCCAAGATATGCCCGAAGACGCAGATACAACAAAGCGATCGCCTGCTTCGACCTTCGGTGACGCGCTGGTTAAGCCATCAAAGCCTG
AAGAACAGGTTAAAACGGAGTCACCTGTTGAAATTGAAGGCACAGCTGAGCAGATGAAAAATGAAGGCTATGAAGCGAGGCAAGCAGGTTCACCTACGGT
AAAAACTGATGATGGCAAGAAAATCAACGGGGAAAAAAAGGAGGAATTCCTGCTCGACATGATGCCAATCCCCAGAAAAACGCCGAAGGAAGGAAAATCA
AATGCGCCTTCACCACGTGCTGAGTCGTTCGTGATCCCAAAGCGGACGTTTGCGAAGACTGACATAGCTGGATCCAAGGTGGTTGCCCAGAAGGAACGAA
TAGACAGCGCAGTGCCTCGAGCAGGTGTTGCTAAGCGCTCATTGGATCCACCTGCGGCCGTCGCAatgttgccgttgccgtctCCTGAATCCAGCCCAAC
ATTGCCAAATGCCAATTCCATTCGTCCTCAGCGGAAGCGAACAAAAAATTCGGTGCCAGTGAAAAGTGCATTGCTTTCAACGCAAGACCGAGCTTTAATG
CGCCTGTCCAGAAAGCGCAATTCCATCTTAATGGCAGCGGCAGAACTGGCAGCCCAGGCTCCTGACATtaagagcagcaggaagggGTCAGCGACACGGA
TGGTGGGATATGAAGTCTATGATGTCGATGGGAAACTTCAACCGGATCTTATTGCTCGTTTAAGCTGCGCTACGAAACGCGAAATTGCATCGAACCGGGA
ATCGTACACGGACTCGTTTTTTGGTGTATCGCGCTTGGTTTCAAATGCAAAAGGAACATCAAGTTCAAGCATCGATGAATGTGGTGAAAATGATCTTGAT
GCTCGCAAGATAAACTGTTACGAGGA