Description :
From Genome Similarity Track
Location :
contig_2:1064258- 1066876
Transcript NameFunction/comments
g821.t1hypothetical protein

Sequence
2618 bases(100 bases per row)
ACGGAGAAGAAGTTGATCAAGACGCAACTGAGTCAGCGGACGATTTGCTGGCGCGAAAGCGGAATGCAGAGACTGAGTTGCGCGAGAAAGCTGTAGCTCT
GCGCGACCTGAAGCTGCATCTTCTGGGCTCCATCGAAGGCGTCGATCTCCGAGAGATTGTGCGGTGGCCACTATTCGTCAAAGCTGTGACGCACGTTCAT
TTCAGGAGACTGTGAGGTCTAGCATCCAGTCCAGTGCGCAGTGGCACCCAGCATGTGCAGGGTTCGCCATGCAGCGCGAGATCAGGCCAAGTTTCAACTT
GAAGAATACAACAAGGCGATATTTTGCTGCCCCCTCCAGCAAAACATGACATAGAGGGTCATACGGATGATAGTGCGAGCAGCTCTGCGGCCAGTGGAGA
TGATAGTGAGGCAGGAGATGACGAAGAAGAAGAAGAAGAGGAACGTGACAAAGGTCAACCAGAAGACAAAAAGGAAGAACTCCCTACAGCCACGGATAAT
GACGGTGTGGATGGAGACGTAAGTGAAGAGGACGAAGAGAGTAGCAGTGAAGACGAGGAACCTGTTCATCCGGTAGCGTCAACCCCTGTGAATGAGGAAG
ACGATGGCAAGCGCTCATTAAACGAAGATACTTTAGCCGAACACACGAACGAAGACTCTAACCAGATGCCACCAAATGGACGAGCCAAGGTCGAAGCGCT
GCTGAAGAAGCCCCGAATTATCAAGCGATCAATTCCTGCCCTTTTCGATGCAACCACAAGAAGTCCAATCTTTTTCGGATATTCTTTCGAGAAACAGAAA
AATCCCGTTGATGAAGCTCTGGAGAGTGAAAGTGCGCTAAGAACGAAAGAAGATGCCATCTTTGACATGAAGATCAAGTACCAAAACGATAAGCTGCAGT
CGACTAGAGCTTCGGAAAGAGGGAAGCTTCAAGCGCTGACTCAAAAAGAGAGCGGCCTTCAGTTGAAGCGTGAGAAGCAGTGGGCGAAGAGACAAGCGGA
CCTCGAGCGCGCGAAAAAAGAATTAGATCCGAGCGATGTCTTCTTCAAAACCAACGAGTCTCAAGACATAAAGACAAGGGACCAGGAAGCGTTCGAAGAC
GCCGAACTTCGACGTCAACAGCAGAATATTGACGCAAGAATGCTAGCAGCAGAGCAGGAGTGTGCACAGTTTCTGGAACAAGTTGCTGCCTTGCGCTGCC
TTGATAAACCGCTGGGGGATCTGCGCTTGACATTCCACGTAGAAGAGCTGGAGAGGTACGAGCACGAGATCAATGCGGCCAAAAATGCTCTTGCCACAGC
ACAGGAAGAGTATGCGGCACTCACAACGTCCAAGCTTCGGGCACCTGGGCAGGAAGCGAAGCTCCGATCTCAGGTATTATTCGCTGAAGACCAAATCAAG
GCACGGGAAAACGAACTGGAACGCATTTGTCGCCTCCACGAGAACGAGCAGTTCCTTCTCGAGCGCGCGCAGGAAGTTTTTGATAAGGAACAACTCTTCG
TGGCTTTGTTCACCTGCCTCAACACCGGGAACGCTTCAATTACTACCAGCATCGACGCCAATTTCGCTTTCCCATTGATTGATGTCGCGGTTGCCATGCT
TCTAGGGGCTGGGAGATGCTCGATATCGGACAAGATTAAATTCCTCTTTGAGATGTTTGCTCGGAGAAGCGAACGACCACGTGCTATCTCTTCTATCAGC
GTTCTGACCTCGGCCTCTCTTGCAGAAGTGCTTCGCGTGGTCTTAAGTGTGCTTTCAAGAATCGGAGATATTCGTCTTCCGCGTGTTTTAACACGAGAGT
TTCTTCAGGAATTTGTGGAGCGCGAATTCTTAAAGCTGAACAGTATATCGTCTAGCGATGATACGGATAACCCCCCTGAGAGGCAGGGAATGACGCTGCA
TGAGTTCACCAAATACTGCTTCGAGACGATTGAGGGCTCGAAATATCTGTGTGAACTGTTGGAACATCCTTGGAAGTACCAACGATTATCCCGTTTTGTG
GTGCAACACATGAGTTCCATCCACCAGTACAGACTCGGCTTGATTAACGTCAACGACTTGAAATACGCCCTGGCTCGACAACTGAATCAACCACGGGAAG
AATTATCCCAATGGAAGAAAAGTATCATTCATGATCGTGCACTCGCCATGGGAGAAAATGATCCACTCAAAACGGATTATTCGAAGTACCTTCCGAAGCG
TAGAGCGAAGCTTCTCTCTAACGTCGTGCCCTTGGACCATGGAGGGTATCGAAACGTACTGCACTATCGCATGGAAGTGATTTTACGCTCTGCGGTAAAA
CTACAGACAGCTTGGCGCGCCAAAAAGGGCAGACAAGTGGCTCGACTCGCAGCCGAAAAGCAAGCTTTCTATCACGCCCGCGGAGTCGCTCTGGAAGAAG
CGCGACAGCGAATAGAGAAAGAATGGAGCGATCGAGACGCCAAACCTGCTCATAGCGTGGACAAAATGAAGTTTGAGGCCAAAATCCGCATGAAGCAGGT
CAAACTACGCACAAAGGGGAATACTTTCAGTCGTGAACAAGTGCTTGCGCTCCTGACGGAGGAAGCTGTTCAAGGCGCTCAAAAGGAAGTCGAGAATCGG
TTCCGCGAAATGGAAGAA