Description :
From Genome Similarity Track
Location :
Scaffold_6:1064051- 1065156
Sequence
1105 bases(100 bases per row)
GCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGTCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAGCTGTTCGAGGCTG
TCAAAGTCTTCAAACTTGACGGCCAGATCCACTTGGACGTTGGAGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGC
TTTCTCTCAAAGCATCGGACAACTTGTTGCTGTTACGAGCAGCCGTCTGGCGGCGTGCAAAATTCTTCGACGCCCCAGAATCGATCAAGATTCTAAAGGG
ATGATCGTATCCCCGTACACATCCGTGTACTACAAGCAACCCGTCGCTGCTCTTCGCCGATTCGAGAGTGCAAAGACTCTCCGGGGCTAAGTCCCCGTGG
TGCGCGCCACCCGCGAACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTTCCGGCGTTCCCCTGTCCCCGGGATCCTGG
CTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTCGAAGTGGCCCATCTTCCCGCAGCCG
AAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCATG
CTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGTAGAGCCACTTGAATCGCTCTTCAAGGGTGCTTGATTGCACCCGGAACAGCTGAGTG
CGTGCGGGGCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCGTTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTT
GCACGTACTCGTGCAGCTCACGCCTCCCTTGTTTACACGAGAGAAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGAAACGCGGCTCGGAGCTG
CTCACACAACTGAACCCAGGATGTGAAACATCCAGGGGATGCTGCTTCCCGTGTGTACACCCAGCTCTTAGCACGGCCGCTAAGGTTGGAGAGTGCAAAA
GCAAC