Description :
From Genome Similarity Track
Location :
contig_2:1064019- 1066013
Transcript NameFunction/comments
g753.t1hypothetical protein

Sequence
1994 bases(100 bases per row)
CGTCCGAGTTACGGAGTTCCTGCGTTGGTACACGGACCTCGTCAAAGTCAGGAAGAAACAAGCGCAAGGCGACGGTGACACGACTCGGGTGGTGCTTTCC
GACACGTTAGACGTGCGCCGCCAAGTTGATGGACTTGCGAAGGAAGTTGCGGTTCTGGAGCAGCTTTTGGCGCAGCTGGAAGCTGAAATTGAGAGTGTAG
CGGTGGAGAATAGCGACGCTGAACCGCAGACGGCCGAACAACTCGCAGATTTTGCAGCAGACGGAGAAGAAGTTGATCAAGACGCAACTGAGTCAGCGGA
CGATTTGCTGGCGCGAAAGCGGAATGCAGAGACTGAGTTGCGCGAGAAAGCTGTAGCTCTGCGCGACCTGAAGCTGCATCTTCTGGGCTCCATCGAAGGC
GTCGAGCTCCGAGAGATTGTGCGGTGGCCACTATTCGTCAAAGCTGTGACGCACGTTCATTTCAGGAGACTGTGAGGTCTAGCATCCAGTCCAGTGCGCA
GTGGCACCCAGCATGTGCAGGGTTCGCCATGCAGCGCGAGATCAGGCCAAGTTTCACCTTGAAGAATACAACAAGGCGATATTTTGCTGCCCCCTCCAGC
AAAACATGACATAGAGGGTCATACGGATGATAGTGCGAGCAGCTCTGCGGCCAGTGGAGATGATAGTGAGGCAGGAGATGACGAAGAAGAAGAAGAAGAG
GAACGTGACAAAGGTCAACCAGAAGACAAAAAGGAAGAACTCCCTACAGCCACGGATAATGACGGTGTGGATGGAGACGTAAGTGAAGAGGACGAAGAGA
GTAGCAGTGAAGACGAGGAACCTGTTCATCCGGTAGCGTCAACCCCTGTGAATGAGGAAGACGATGGCAAGCGCTCATTAAACGAAGATACTTTAGCCGA
ACACACGAACGAAGACTCTAACCAGATGCCACCAAATGGACGAGCCAAGGTCGAAGCGCTGCTGAAGAAGCCCCGAGTTATCAAGCGATCAATTCCTGCC
CTTTTCGATGCAACCACAAGAAGTCCAATCTTTTTCGGATATTCTTTCGAGAAACAGAAAAATCCCGTTGATGAAGCTCTGGAGAGTGAAAGTGCGCTAA
GAACGAAAGAAGATGCCATCTTTGACATGAAGATCAAGTACCAAAACGATAAGCTGCAGTCGACTAGAGCTTCGGAAAGAGGGAAGCTTCAAGCGCTGAC
TCAAAAAGAGAGCGGCCTTCAGTTGAAGCGTGAGAAGCAGTGGGCGAAGAGACAAGCGGACCTCGAGCGCGCGAAAAAAGAATTAGATCCGAGCGATGTC
TTCTTCAAAACCAACGCGTCTCAAGACATAAAGACAAGGGACCAGGAAGCGTTCGAAGACGCCGAACTTCGACGTCAACAGCAGAATATTGACGCAAGAA
TGCTAGCAGCAGAGCAGGAGTGTGCACAGTTTCTGGAACAAGTTGCTGCCTTGCGCTGCCTTGATAAACCGCTGGGGGATCTGCGCTTGACGTTCCACGT
AGAAGAGCTGGAGAGGTACGAGCACGAGATCAATGCGGCCAAAAATGCTCTTGCCACAGCACAGGAAGAGTATGCGGCGCTCACAACGTCCAAGCTTCGG
GCACCTGGGCAGGAAGCGAAGCTCCGATCTCAGGTATTATTCGCTGAAGACCAAATCAAGGCACGGGAAAACGAACTGGAACGCATTTGTCGCCTCCACG
AGAACGAACAGTTCCTTCTCGAGCGCGCGCAGGAAGTTTTTGATAAGGAACAACTCTTCGTGGCTTTGTTCACCTGCCTCAACACCGGGAACGCTTCAAT
TACTACCAGCATCGACGCCAATTTCGCTTTCCCATTGATTGATGTCGCGGTTGCCATGCTTCTAGGGGCTGGGAGATGCTCGATATCGGACAAGATTAAG
TTCCTCTTTGAGATGTTTGCTCGGAGAAGCGAACGACCACGTGCTATCTCTTCTATCAGCGTTCTGACCTCGGCCTCTCTTGCAGAAGTGCTTC