Description :
From Genome Similarity Track
Location :
Scaffold_1233:1064- 2937
Transcript NameFunction/comments
g16568.t1OWY95693.1 Copia type Polyprotein, partial [Phytophthora megakarya

Sequence
1873 bases(100 bases per row)
TGGTGGCCAAGGGGTTTTCACAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCTAGC
TGCCAAGTACAGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGATGGCTAT
GTGGACTAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTCA
TGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCATCTACCTGGAGCGTGACGGCCAAGACATGATCTTCGTGGCGCTGTACGTTGACGACTT
GGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTAAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCTC
GGGATGGAGATCAAGAACGCCCGCGACTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCTATCCTGACCAAGTTCGGCATGCAAGACAGCA
AGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGGCCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACATGATGAAGAACGTGCCGTATCG
GAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACACGTGTCCG
ACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCGTTGGTATGTGTGGAT
ATTCGGATGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAA
GCAGCGGACGGTGGCTCTGTCTTCAACGGAAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTC
GGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACTCGCAGTTCCACAAGCGCACCAAGCACA
TCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACGGACATGCTGGCGGGCATGATGACGAA
GGCGATCACTGCGGTGCAGTTCCAAGTTCTTCGGAGCAAGCTCGGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCT
CGGGCAGCTGCCGTATACCGGTAGGATAACGGTATGACCTTCACTCAGTGGGACCGCAATCATTTCTGTGTTGACGGGACGCTGATGATGGGACGCGGGA
CACTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATC
CACGTGGCAGTCGCTGACTGGCTGAAGCAACTCAGTATGCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGG
GAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAACCGACCAAAGCCTTTTGCAACAAGTGTTATTCGAGAACGAAGAAATCTCA
GCACAAGAAACTCAAGCAGCAATCCAAGCCACAGGAACGTACCAAGTCATGGCAATAGCAAGCGCGTGGAAAC