Description :
From Genome Similarity Track
Location :
Scaffold_10:1063889- 1065027
Sequence
1138 bases(100 bases per row)
GCCTCGTCGATCGGAGTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCCTGCCCTGCTGCAGGTCGAGGAACT
CCGCCCTCGACCGGAACTCGTTTTGCGGTAGCTCAAACGCTCGTCTGAGCTCATCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCG
GCGTCCATACGCCCAACTTCTTGCGCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTG
TCGAGTTCGACAAGCCAACGGAGGAGGGGATCACCCTCTCTTCCGACATAGTTACTCACATTGAGTTTCAGGGATTGCGCGCGTGGTGTCGTCCCGGACG
GCACCGCGGTAGTGGCAGCAACATCGCGTTGCTCCTTCAGGATGAAACCCAGAGCAACACCGTGTTGCTCTGTTGGCGTTAGCGTACGCAGCATCGTAGC
TGCAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGC
GTAGTGGAGCTTTCCATGGGCACCTCTGTATCCATAGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGG
ACTACAAAGTGCTACCAGGTGTAGTGGGCCTACTTCGGCTCACTACTTTAGCTTACACGTGTGCGCACGTGTGTGAGGAAGCGTAGCTTAGTTTAAACTA
GAGTTAATTATGCTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGTGTTAAAATGAGAACTGCTATTTTGTTTTATGCT
TTCTGACTTCCTCCAAATGTAATATTCTAAGTTGGGAATCTGTCAACGGCTGGTTGGCAGAATTACAATGCTATGCATGTCTCTCATTGGCTAAAATATG
CTGCTTTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTTGTGGTGATCATAAATGTATGTAGCCTTTGGTGTGTTTGGTGTGGCTACACCAAG
GTCGAGAGAGTCTTTCGAACCTCCAACAGACGTCGTCG