Description :
From Genome Similarity Track
Location :
Scaffold_261:10637- 13296
Sequence
2659 bases(100 bases per row)
GATAGGGGCGTACGTCATGAAACTGACTCGGTTCCTGGAACTAAATACTGCGTTACACGGCAGTGGCCTTTACCAAAGGAACAATATGACGTCATTGACG
AGATTGACTGTGCTAAGCACCGCCGCAGGACTGGTACGTGAGAGTAAATCTCTGCACTCGACACTGACATTTTGTGTTGAAGGCTGAAAGGTAAGTGGTG
TATTGTGCATGCTAGTGACGAGCTTAAAGCGGCCACTATTTCGGCACGGACACCCATTCCTCGAAGTAAGTTCTTCCCAAAAATATAGTTGATTGTACTA
TGTATAGTGCACTCGACTTGGTCGGTGGATATTACCAATTGCTTATGCAAGCGAGTGATATTCCGCTGACAGCCGTGAGCACTCCGAGTGGTATGTTATG
GGAATGGCTGGTGATGCCCCAAGGGCTGTCTAATGCTCCGGCAACATTTAATCGTCTAGTGACGCAAATTTTTCGTCCAGGTCAGGATCACGCACAGACG
CACTTTGATGACATTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCAGATGTTGAGAATCACATCGGTCATTTGCGAGCCGTGCTCGAGTGCATGCGCA
CTAATAAATTGTGCGCCAACGCGTCTAAATGCATATTTGGTCAGAAGATATTCCTTTTCTAGGATGTTTCATTGGTAAACGCGGCCTTGGAGAGGATACC
GCTAAGTTCAAGGCTATACTGTACTGGCCGATTCCTAAGAACCAAAAAGACTTGCGTAAGTGGCTTGGCCTCGCCAATTACTAACACAAATACATTGAAA
ATTAAGCTGATATGGCTCGTCCATTAACTGATCTCCTTAAGAAGGACATAGATTGGCGCTGGGACAACATCCATTCCAACGCATCTAGAGCAGTAAAGGA
AAGTCTCCTCCATGCTCCCATTTTGGCGTTGCCAATCCTGAGTACCCTTTTGTTGGTGTCTGCAATGCATCCGACTTTTCCATAGGCAGCGCCCTGTTTC
AAACAGATGCTGTAGGCCGCGAGCGAGTTATAGCATTTGAATCTCGTCAGTGAAAGCTGCTGAAAAGAACTATCCAGTTCATAACAATGAGCTACTTGCT
ATGAAGCATGCGCTCGTCAGATTTAGAGTCCATCTGCTTGGCTCCAAGCCATTCGTCATCTATACGGATCATGCGTCATTACGCACGGCGACACAGTCGC
CTCACCTCTCTCAGAGAAAGGCTTTGCGGAATATAACTTCAAGGTGAAGTATAAGCCAGGTAAACAAAATGAGTTGTCAGATGCCCTCTCTCGCAGACCT
GATTATGAGCTTGCTCATGTCACGACTTTGTCTTCTCCTATTGAAGAGTTAATTCGTGTGGCACATCCACGGGATTCTTAGTGTGTGGTATTGTTTCATG
CCCTTGAGAGTGAGGAATATAAGGACTCGGGTAGTCAATTATCGGCACGCTTTCGGGCCAGCCTACATCGATATTCCATCGATAATGGTCGCTTGTGCTA
CCGCACAGATGTAGCAGATACCGCTCGCATTGTTCACCTCACAATGAGGATTTAAAGTATCGAATCCTCTTTGAGGCCCACGATACTGCCCTCAGTGGGC
ATTTGGGCCGGGAAAAGACTTATGGCTATGTGCGTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATACGTGCGTACATGCGAATCGTG
CCAGCGGTTCAAACCCTCAGTACATTCGGTTGCGTCACTCGCCAGTTTACCCGTGCCCACGGGGTGTTGGGAGTTCATCAGTACGGATTTTATGCTTGGT
CTTCCCAAAGACTGTGATCGCAATACGGGAATTGTCGTCTTTGCTGACTATTTAAGCAAGATGGCTCACTTGGCGGCGGTGCCGGATTCCATCGATGGCA
AAGGTACAGCTATGCTGTTTATCTATCGTTTGATTCGTCAACACGGGTTGCCTCTGGCAATCATCTCTGATCGCGACCTTCGCTTCACAGGCAAGTTTTG
TACTTCCATCTTCAAGGTGCTTGGCACCACCCGATTGGACATGTCCACAACGGATCATCCGCAGATCGATGGTCAGACTGAGCGAGTTGATCGCGTCATT
GGCGACGTTCTTCGCAGTGTTTGTGCTGAGTCGCCTAAGACTTGGAGCTCGATGCTCCCTGTCATTGAGTTTGCGTTGAGCAACGCTGTTCATGTCTAGC
GGCTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGCGTTCCGCTCACGATACCACTACGCGGTTCTGGGCTTGGTGAGGAGAGCCTGCTGACAA
GCTTGCTGAAATCAGCCCTACAACGATGCAGAAACAAGTGAGCGAGTTTCTCGCGATGAGAATTGGTGTCTTACTCCATGTTGCGTGATGCAACGGCTGA
TAGCCAAGAGAAACAAAAGTAACAAGCTGATGCTAAAGGCAGAGGATGTATTGATTCTTATGAAGTTGGAGACCAAGTCTTATTAAAATGCTAAAAACCT
ACCTACAAATGTAGTGTAGGCCGTCTTCAAGACGAAATTGCGTCCGCGCGTCATTGGGCTGTTTGCGGTCATAGCGAAGAAAGGCCTTGCCTAGACACTC
AACCTTCCGCGCAAGTTGCGCACACACCCAGTGTTTTACGTTGGCTTGCTTAAGCCGTA